ID: 1068711240

View in Genome Browser
Species Human (GRCh38)
Location 10:60136429-60136451
Sequence TGTCTAATGCAGAGAGTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 176}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068711240_1068711248 26 Left 1068711240 10:60136429-60136451 CCGGCCACTCTCTGCATTAGACA 0: 1
1: 0
2: 1
3: 14
4: 176
Right 1068711248 10:60136478-60136500 TGGCATGATATGTTAACATTGGG No data
1068711240_1068711243 6 Left 1068711240 10:60136429-60136451 CCGGCCACTCTCTGCATTAGACA 0: 1
1: 0
2: 1
3: 14
4: 176
Right 1068711243 10:60136458-60136480 TCTTCAAATTATGGTCCCCATGG No data
1068711240_1068711249 27 Left 1068711240 10:60136429-60136451 CCGGCCACTCTCTGCATTAGACA 0: 1
1: 0
2: 1
3: 14
4: 176
Right 1068711249 10:60136479-60136501 GGCATGATATGTTAACATTGGGG No data
1068711240_1068711242 -3 Left 1068711240 10:60136429-60136451 CCGGCCACTCTCTGCATTAGACA 0: 1
1: 0
2: 1
3: 14
4: 176
Right 1068711242 10:60136449-60136471 ACATTCATTTCTTCAAATTATGG No data
1068711240_1068711247 25 Left 1068711240 10:60136429-60136451 CCGGCCACTCTCTGCATTAGACA 0: 1
1: 0
2: 1
3: 14
4: 176
Right 1068711247 10:60136477-60136499 ATGGCATGATATGTTAACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068711240 Original CRISPR TGTCTAATGCAGAGAGTGGC CGG (reversed) Intronic
904568683 1:31444346-31444368 TGTCTACTTCAGGGAGTGGGTGG - Intergenic
906594281 1:47060618-47060640 TGTCTAATACTGACAGTGGAGGG - Intergenic
908766081 1:67555691-67555713 TGAGGAATGCAGAGAATGGCAGG + Intergenic
910010503 1:82455447-82455469 TGTCACCTGCAGAGAGAGGCTGG + Intergenic
911646946 1:100347493-100347515 TGTCTGATACAGAATGTGGCTGG + Intergenic
914994931 1:152535245-152535267 TGTCTCCTGCAGAGAGAGACGGG - Intronic
920676359 1:208041152-208041174 TTTCTAATGCTCAGATTGGCAGG + Intronic
920805379 1:209229024-209229046 TGTTTAATGCAGAAATTGGCTGG + Intergenic
920863884 1:209735266-209735288 TGTCTAAATGAGTGAGTGGCAGG - Intergenic
923576782 1:235165642-235165664 TCTTTAATACAGAGAGAGGCCGG - Intronic
924614516 1:245601596-245601618 TATGTAATGCATAGAGTAGCAGG - Intronic
1064196643 10:13249013-13249035 TGTCTAAGGAAGAGAGAGGCAGG + Intergenic
1068711240 10:60136429-60136451 TGTCTAATGCAGAGAGTGGCCGG - Intronic
1069571988 10:69499874-69499896 TGAGAAATGCACAGAGTGGCTGG + Intronic
1069839946 10:71333529-71333551 TTTCTACTACAGAGAGAGGCTGG + Intronic
1070056963 10:72944889-72944911 TGTTTACTGAAGAGAGGGGCTGG - Intronic
1072818209 10:98530617-98530639 TCTCTAATGCAGAGACTGCCAGG - Intronic
1074321888 10:112410906-112410928 TGTCAAATCAAGAGAGTGGTGGG - Intronic
1074362116 10:112832149-112832171 AGTCTGCGGCAGAGAGTGGCTGG + Intergenic
1075139102 10:119815637-119815659 GGTCTAAGGCAGAGATGGGCAGG + Intronic
1076419281 10:130317950-130317972 TGTCTAATGTTGACAGTGGGGGG + Intergenic
1078190541 11:9090178-9090200 TGTCTAGTGGAGAGAGAGGAAGG - Intronic
1080322337 11:31025999-31026021 TGTAAAATGCAGAAAGTGCCAGG + Intronic
1081848928 11:46261307-46261329 TGTTTAGTGCAGAGCCTGGCTGG + Intergenic
1083196502 11:61091662-61091684 TGTAAAATGCAGAGATTGGATGG - Intergenic
1083538747 11:63495991-63496013 GGTATAATCCAGAGGGTGGCAGG - Intergenic
1085618707 11:78021749-78021771 TGTTTAATGCAGGGAGTGACAGG - Intronic
1087766618 11:102162298-102162320 TGTCTGTTGCAGAGGGAGGCTGG + Intronic
1089351810 11:117825574-117825596 TGTCTAAGGCACAGAGAGGTAGG + Intronic
1089541394 11:119191001-119191023 GGTATATAGCAGAGAGTGGCGGG + Intronic
1090017348 11:123097974-123097996 TGAGTAATGCAGAGACTGGATGG + Intronic
1095800620 12:46267849-46267871 TCTAAAATGCAGAGGGTGGCAGG - Intronic
1098643007 12:72861111-72861133 AGTCTAATGGAAAGAGTGGGGGG + Intergenic
1098659575 12:73075457-73075479 TGTCTGTGGCAGAGAGGGGCTGG - Intergenic
1099424087 12:82501514-82501536 TGTGCACTGGAGAGAGTGGCAGG + Intergenic
1100907556 12:99319252-99319274 TGTCTAATGTTGACAGTGGGGGG + Intronic
1101636701 12:106549486-106549508 TGTCTAATGTTGACAGTGGGAGG + Intronic
1102829232 12:115980663-115980685 TATCTAACCCAGAGATTGGCTGG - Intronic
1102979241 12:117228399-117228421 TGACTCATGCAGGGAGTGGCAGG + Intronic
1103105846 12:118224032-118224054 TGCCTAAGGCAGTGAGTGCCTGG - Intronic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1104933846 12:132354236-132354258 TGTCTCGTGAAGAGTGTGGCGGG + Intergenic
1105073903 12:133258376-133258398 ACTCTAATGAAGAGACTGGCTGG + Intergenic
1106954838 13:34925083-34925105 TGTTCAAAGGAGAGAGTGGCAGG + Intergenic
1108307319 13:49151160-49151182 TGTCTAATGCTGAGAGTGGGGGG + Intronic
1112275047 13:98009453-98009475 TGTTTAATGAATGGAGTGGCAGG + Intronic
1117621473 14:57591438-57591460 TGGCTTATGCAGAGAGTAGAAGG + Intronic
1121597057 14:95171901-95171923 TGTGTAAGGCAGAGATGGGCAGG - Intergenic
1121634622 14:95445614-95445636 AGTCTTCTGCAGAGAGTGACAGG - Intronic
1126348497 15:47719852-47719874 TGTTTAATGTAGTGAGTGACAGG + Intronic
1127679153 15:61275857-61275879 TGCCTCATGCAGAGCCTGGCTGG + Intergenic
1129564397 15:76606595-76606617 TGTCTAATGTTGACAGTGGGGGG + Intronic
1131843017 15:96458261-96458283 TGTAGACTGAAGAGAGTGGCTGG - Intergenic
1133580046 16:7136103-7136125 TGTCAAAGGAAGAGATTGGCTGG + Intronic
1134374299 16:13656573-13656595 GGGCCAATGCAGAGAGTGGTGGG + Intergenic
1135177636 16:20244978-20245000 AGTCTGAGGCAGAGAATGGCAGG + Intergenic
1135520471 16:23172949-23172971 TGCCTAATGCACAGTGGGGCTGG - Intergenic
1136454431 16:30372232-30372254 TGTCTGAGGCAGGGAGGGGCTGG + Intronic
1136749811 16:32624157-32624179 TGTCAACTGCAGGGAGTGTCAGG + Intergenic
1141781541 16:86165257-86165279 TCTCTAATGCAGAGAGAGAAAGG + Intergenic
1141829378 16:86501178-86501200 TGTCGACTGCAGAGGGTGACTGG + Intergenic
1141977894 16:87529773-87529795 TTTCCAATTCAGGGAGTGGCAGG + Intergenic
1142146243 16:88494080-88494102 TGTGTAGCGCAGAGTGTGGCTGG + Intronic
1142205411 16:88780446-88780468 AGGCTAAGGCAGAGAGGGGCAGG + Intronic
1203051945 16_KI270728v1_random:883355-883377 TGTCAACTGCAGGGAGTGTCAGG + Intergenic
1203143079 16_KI270728v1_random:1781633-1781655 TGTCTATTGGAGAGAGTAGGTGG + Intergenic
1203143184 16_KI270728v1_random:1782328-1782350 TGTCTATTGTAGAGTGTGGGTGG + Intergenic
1203143191 16_KI270728v1_random:1782376-1782398 TGTCTATTGCAGAGTGTAGGTGG + Intergenic
1203143221 16_KI270728v1_random:1782616-1782638 TGTCTATTGCAGAGTGTAGGTGG + Intergenic
1145974374 17:28975905-28975927 TGCCAAGTGCAGAGAGAGGCAGG + Intronic
1146610513 17:34300897-34300919 TGTCTTCTGCAGAGAGTGGGTGG - Intergenic
1146647787 17:34586658-34586680 TGTGTATGGCAGAGAGTGGGTGG - Intronic
1147002977 17:37378196-37378218 TCTTTAATGCAGAGAGGGGTAGG - Intronic
1147902256 17:43796068-43796090 TGTCTAATGTTGACAGTGGGGGG + Intergenic
1149744531 17:59082961-59082983 TGTTTTACGGAGAGAGTGGCAGG - Intronic
1153049132 18:884672-884694 AGTCCTACGCAGAGAGTGGCAGG - Intergenic
1153887285 18:9478147-9478169 TGACTAATGCAGAAATTGGGGGG + Intronic
1155825648 18:30439361-30439383 TGTCTAGAGCAGAGGGAGGCAGG - Intergenic
1156427074 18:37025285-37025307 TGTCTAATGTTGACAGTGGGGGG - Intronic
1159893319 18:73973253-73973275 TTTCTAAGGAAGACAGTGGCGGG - Intergenic
1160006546 18:75072952-75072974 TGTCTAATGCAGAAATCAGCTGG + Intergenic
1162102292 19:8346798-8346820 TTAAAAATGCAGAGAGTGGCCGG + Intronic
1162359142 19:10207065-10207087 TGTCTTAGGCAGAAAGAGGCTGG - Intronic
1166654912 19:44603936-44603958 TGTCTTCTGCAGAGAGAGGGGGG + Intergenic
1166866810 19:45843572-45843594 TGTCTAATGTAGAGAATCTCAGG + Intronic
927146729 2:20171070-20171092 TGTCAAATGCAGAGACTAACAGG - Intergenic
927455460 2:23245321-23245343 TGTCTAAAGCTGAGAGGGTCTGG - Intergenic
928802374 2:35110431-35110453 TGTCTAATGTTGACAGTGGGGGG + Intergenic
930758686 2:55006951-55006973 AGTCAAATGCAGAGTGAGGCAGG - Intronic
932800260 2:74735619-74735641 TGTCTAATACAGAGAAAGCCTGG - Intergenic
933780527 2:85797500-85797522 GGCCTAATGCAAAGAGTGGCTGG - Intergenic
935346232 2:102111057-102111079 TGGCCAATGAAGAGAGTGGAAGG + Intronic
938409051 2:131048761-131048783 TCTCTAAAGCAGAGTGTGGTTGG - Exonic
944662697 2:201934419-201934441 TGTCCAAGGCAGAGAGAAGCAGG + Intergenic
947364480 2:229380195-229380217 TTTCTAATGTAGAGGGTGGCCGG - Intronic
947950169 2:234139913-234139935 TGACTAAGGGAGAGAGTGCCAGG - Intergenic
1170429648 20:16264413-16264435 TCTCTAATCCAGGCAGTGGCAGG + Intergenic
1172119027 20:32586774-32586796 TGTGAAATGCAGAGAGAGGTTGG - Intronic
1172293218 20:33790818-33790840 TGGCTGGCGCAGAGAGTGGCTGG + Intronic
1175331595 20:58168402-58168424 TGTCCAATGCAGACAGGGACGGG - Intergenic
1177475566 21:21616314-21616336 AGTGTAATGTAGAGAGTAGCAGG + Intergenic
1180874120 22:19166759-19166781 TGGCACATGCAGAGACTGGCCGG - Intergenic
1181949404 22:26543175-26543197 TATCCAATGCACAGAGAGGCCGG - Intronic
949957340 3:9279829-9279851 TGGCAAATGCAGAGGGTGCCAGG + Intronic
951700063 3:25487332-25487354 TGTTGAAAGCAGAGAGTGGTAGG - Intronic
952256975 3:31704156-31704178 TGGCTAATGCTGAGATTAGCAGG + Intronic
952431291 3:33226001-33226023 TGCCTAATGAACTGAGTGGCTGG - Intergenic
955677871 3:61468196-61468218 TGTTTAATGCAAAGAATGGTTGG - Intergenic
955781778 3:62492377-62492399 TGTCTACTGCAAAGAGTGACAGG + Exonic
958789683 3:98637027-98637049 TGTCTAAGGCTGAGAGTAGGGGG - Intergenic
961036171 3:123643370-123643392 TGTCTGAGGCAGTGAGTGGTGGG + Intronic
964842885 3:161013603-161013625 TGTCTAATGTTGACAGTGGGGGG + Intronic
964846033 3:161045184-161045206 TGTCTAATGTTGACAGTGGGGGG - Intronic
967825545 3:193874455-193874477 TGTCTACTGCAGGGGGTGACAGG + Intergenic
969583464 4:8078760-8078782 GGACTAATGAAGAGAATGGCAGG + Intronic
969949020 4:10814486-10814508 TTTCTACTACATAGAGTGGCTGG - Intergenic
971039585 4:22736753-22736775 TGACTAATTCAGAGAGTTGTTGG + Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
972829472 4:42798140-42798162 TGACTATTGCTGAGAGTGGAAGG - Intergenic
975470276 4:74758147-74758169 GGTCTAATGCAGGCAGTGGGAGG + Intronic
977741077 4:100483391-100483413 TGTCAAAAGCAGAGAGCAGCTGG - Intronic
978188863 4:105890381-105890403 TGTAGAATGAAGAGAGTGGAGGG - Intronic
978821720 4:112974338-112974360 TGTCTAATGTAAAGAGTGAGAGG + Intronic
979317069 4:119277679-119277701 TGTCTAATGTTGACAGTGGGGGG + Intronic
980113765 4:128659593-128659615 AGGCTAATGCAGACAGTGGTTGG + Intergenic
982415865 4:155131144-155131166 TGCCCAAAGCAGAGAGAGGCCGG + Intergenic
984605008 4:181775109-181775131 TGTCAACTGCAGAAAGAGGCCGG + Intergenic
987534675 5:19168648-19168670 TATATCATGCAGAGATTGGCTGG - Intergenic
987923631 5:24314121-24314143 TGTCTAATACTGACAGTGACAGG + Intergenic
989570910 5:42945109-42945131 TGTCTTATCCAGAGACTGGAGGG + Intergenic
989577430 5:43001156-43001178 TGTCTTATGCAGAGATTGGAGGG + Intergenic
989581216 5:43034782-43034804 TGTCTTATGCAGAGATTGGAGGG + Intergenic
993154211 5:84201518-84201540 TGTCTAATGCAAAGAAGGACTGG + Intronic
994963811 5:106640108-106640130 TGTCTAATGCAAAGATTGTGAGG + Intergenic
996812285 5:127530282-127530304 TGTTTTATGCAGGGTGTGGCTGG + Exonic
997264866 5:132489702-132489724 TGTCTCCTCCAGAGACTGGCTGG - Intronic
997704770 5:135938376-135938398 TTTCTATGGCAGAGCGTGGCTGG - Intronic
998737968 5:145164670-145164692 TGTCTAATGCTGAAAGTGGGAGG + Intergenic
1001585152 5:172828987-172829009 TGTTTTAAGCAGAGAATGGCTGG - Intergenic
1001693934 5:173655514-173655536 CCTCTATTACAGAGAGTGGCTGG + Intergenic
1001873022 5:175174103-175174125 TGTGTCATTCAGAGAGTGGCTGG - Intergenic
1003871560 6:10407587-10407609 TTTCTAATGCAGAAACTGACAGG + Intronic
1008448854 6:51625749-51625771 TGCCATCTGCAGAGAGTGGCAGG - Intronic
1009300713 6:62015448-62015470 TGCCTAAGGTAAAGAGTGGCAGG - Intronic
1010264104 6:73848627-73848649 TGTCTAATGCTGAAAGTTGGGGG + Intergenic
1011477001 6:87758041-87758063 ATTCTAATACAGAGAGTGCCAGG - Intergenic
1015622557 6:135146870-135146892 TGTTTAATGCTGAGAATGGGAGG + Intergenic
1016409363 6:143765685-143765707 GGTCTAAGGCAGAGACGGGCAGG - Exonic
1016700822 6:147052167-147052189 TGTCTAGTACAGATAGTAGCTGG - Intergenic
1018925137 6:168200657-168200679 AGTCTAAGGCAGACAGTGGGAGG + Intergenic
1022948295 7:35310081-35310103 TGGCTAATGCAGAAAGTGTAGGG + Intergenic
1030593510 7:111508926-111508948 TTTCTAATATTGAGAGTGGCAGG - Intronic
1033652038 7:143351088-143351110 TTTCTTATGCAGAGATTGGAGGG + Intronic
1034150572 7:148911934-148911956 AGGGTACTGCAGAGAGTGGCTGG - Intergenic
1034213102 7:149382377-149382399 TGGGTAACTCAGAGAGTGGCTGG + Intergenic
1035494655 7:159313422-159313444 ACTCTAATGAAGAGACTGGCTGG + Intergenic
1037893257 8:22635344-22635366 TCTCTAGTGCTGAGAGTGCCTGG + Intronic
1038155361 8:24984175-24984197 TGACTAACTCAGAGAGTGGCTGG + Intergenic
1039021219 8:33208910-33208932 AGTCTATGGCAGAGAGGGGCTGG - Intergenic
1039177502 8:34825986-34826008 TGTCTCATGCAGGGAGAGACAGG + Intergenic
1040729241 8:50422531-50422553 TGTCTCCTGCATGGAGTGGCTGG - Intronic
1043274085 8:78371679-78371701 TGTGTAATGGAGAGGCTGGCTGG + Intergenic
1044590611 8:93910735-93910757 AGTCAAAGTCAGAGAGTGGCTGG + Intronic
1046287164 8:112109154-112109176 TGGCTAATGCAGAGTGAGGAAGG + Intergenic
1046425247 8:114039196-114039218 TGTCCAATGCTGAGAGTGATGGG - Intergenic
1048525170 8:135195950-135195972 TGTGACAGGCAGAGAGTGGCTGG - Intergenic
1049017302 8:139929886-139929908 GGTCTGAGGCAGAGAGGGGCTGG - Intronic
1049689149 8:143951184-143951206 AGTCTAAAGAAGAGGGTGGCAGG + Intronic
1050016675 9:1241217-1241239 TGATTAAAGCAGAGAGAGGCTGG - Intergenic
1050049716 9:1586997-1587019 TGTCTAATGTTGACAGTGGGGGG + Intergenic
1050801928 9:9626171-9626193 TGTCTAGTGGAGAGTGGGGCTGG - Intronic
1051714790 9:19971206-19971228 TGTCTTGTGCAGGGATTGGCTGG - Intergenic
1052038731 9:23713561-23713583 TTTCTAATGCAGAGAGCTACCGG - Intronic
1053162485 9:35823024-35823046 TGCCTGATGCATAGAGTGGTGGG - Intronic
1056483078 9:87025652-87025674 TGTATAATAAAGAGTGTGGCTGG - Intergenic
1056788848 9:89612373-89612395 TGTTAAAAGCAGAGACTGGCTGG + Intergenic
1058441698 9:105014400-105014422 TGTTTAATGCTGTCAGTGGCAGG + Intergenic
1060017585 9:120099910-120099932 TGTCTCAGGCAGTTAGTGGCAGG - Intergenic
1062122566 9:134841627-134841649 TGCCTAAGGCAGTGTGTGGCAGG + Intronic
1185549484 X:971868-971890 TGTCTATTGCAAAGTGTGGGTGG - Intergenic
1186408323 X:9323401-9323423 TGTCCAGTGCAAAGAGTGTCGGG - Intergenic
1188517043 X:30998936-30998958 TGAATAATGGAGAGAGTGGTAGG - Intergenic
1188806728 X:34600011-34600033 TGTCTAATGCTGTCAGTGGAGGG + Intergenic
1190056697 X:47185373-47185395 TGCCCAAGGCAGAGAGGGGCGGG + Intronic
1191014472 X:55793758-55793780 TGTATAATGCAGGGGGTGGGAGG - Intergenic
1191732182 X:64348752-64348774 TGTAAAATCCAGAGAGAGGCTGG + Exonic
1196001461 X:110791446-110791468 TGGAGAAAGCAGAGAGTGGCAGG - Intronic
1196641947 X:118072796-118072818 TGTCAAATGGAGAAAGAGGCTGG + Intronic
1196914953 X:120523947-120523969 TGTTTAATGCTGTGAATGGCAGG - Intergenic
1197069787 X:122282319-122282341 TGTCCAATGCTGAAAGTGGAAGG - Intergenic
1200101235 X:153689882-153689904 GGTCTAAGGCAGAGGGTGGGTGG - Intronic
1201472452 Y:14349188-14349210 TGGCTAGTGGAGAGATTGGCAGG - Intergenic