ID: 1068713966

View in Genome Browser
Species Human (GRCh38)
Location 10:60166927-60166949
Sequence GAGCAGACTGTACATTTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 191}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068713966 Original CRISPR GAGCAGACTGTACATTTTAA TGG Intronic
900087676 1:906150-906172 GAGGAGACTGAACATGCTAAAGG - Intergenic
902791751 1:18773623-18773645 GTGGAAAATGTACATTTTAATGG - Intergenic
907426717 1:54384368-54384390 GTGCAGTCTGTGCATTTGAATGG - Intronic
907853985 1:58283359-58283381 GAGTAGCATCTACATTTTAAGGG - Intronic
908594286 1:65669994-65670016 CAGCAGAATATGCATTTTAAAGG + Intergenic
909297642 1:73971104-73971126 GAGCAGACCGCACAGGTTAAGGG + Intergenic
909805047 1:79864187-79864209 GAGTAGACAGGACATTTTAGAGG + Intergenic
910342230 1:86201130-86201152 GAGGAGACTGGATATTTTCACGG - Intergenic
910468005 1:87520946-87520968 TAGTTGACTGTACATTTTAAAGG - Intergenic
911295424 1:96108689-96108711 GTCCAGAGTGTGCATTTTAATGG + Intergenic
912077668 1:105896391-105896413 GAGAAAACTGTATTTTTTAAAGG - Intergenic
913127320 1:115804719-115804741 GGGCAGACTCTACAAGTTAAGGG - Intergenic
913313537 1:117529795-117529817 CATCAGATTGTACATTTAAATGG - Intergenic
913691392 1:121282913-121282935 GGGCAGACTGTACATTGAGAGGG - Intronic
914146153 1:144997069-144997091 GGGCAGACTGTACATTGAGAGGG + Intronic
914919148 1:151835962-151835984 TAGCATTCTTTACATTTTAATGG + Intergenic
916984153 1:170172642-170172664 GAGAAGACTGTATATTTTGTTGG - Intergenic
917195568 1:172461612-172461634 AAGCACACTGGAAATTTTAAAGG - Intronic
918076680 1:181176032-181176054 GAGCATACTGGGCATTTTCAAGG + Intergenic
918587502 1:186204639-186204661 AAGCAGCATGTATATTTTAAAGG - Intergenic
919856216 1:201708095-201708117 GAGCATACTGTCCATGTCAAGGG - Intronic
920001158 1:202799898-202799920 GAGAAGTCTTTAGATTTTAAGGG + Intronic
920478717 1:206301390-206301412 GGGCAGACTGTACATTGAGAGGG - Intronic
923459626 1:234197064-234197086 GAGGTGACTGGGCATTTTAAAGG + Intronic
923796015 1:237156278-237156300 CACCAAATTGTACATTTTAAAGG + Intronic
924002618 1:239570712-239570734 GAGCAGACTATATAATTTAAGGG - Intronic
924068094 1:240246642-240246664 GATCAGAATCTGCATTTTAAAGG + Intronic
924797555 1:247302996-247303018 GAGCAGACAGTGCATGTTATGGG + Intronic
1064320388 10:14299221-14299243 AAGCAGACTGTTCTTTTTTATGG - Intronic
1067131700 10:43571111-43571133 GAGCAGACTTGATATTCTAAAGG + Intronic
1068713966 10:60166927-60166949 GAGCAGACTGTACATTTTAATGG + Intronic
1068858291 10:61820109-61820131 GAGCAAACTGACCTTTTTAATGG - Intergenic
1069344019 10:67446237-67446259 GAGCACAGTATAGATTTTAAGGG - Intronic
1071410233 10:85384400-85384422 GAGAAGAATGTATATTTTTAAGG - Intergenic
1071691179 10:87820978-87821000 GAGCAGACTGTAGACTTTCTGGG + Intronic
1074278657 10:112029318-112029340 GAGGTGACTGGACTTTTTAAAGG + Intergenic
1075440125 10:122473618-122473640 CAGCAAATTGTACACTTTAAAGG - Intronic
1080108854 11:28542871-28542893 GAGCAGAATGTCCCTTCTAATGG - Intergenic
1082611855 11:55309296-55309318 GAGCAGAATGTTCTTTTGAAGGG - Intergenic
1085862126 11:80246469-80246491 GAGAGGACTTCACATTTTAAGGG + Intergenic
1085880361 11:80460335-80460357 TAGTAGACTGTAATTTTTAAGGG - Intergenic
1086891537 11:92264488-92264510 GAGCAAACTGTGCATTTAGAGGG + Intergenic
1087008593 11:93492698-93492720 GAGCAGCCTGAAGGTTTTAAGGG + Intronic
1088315640 11:108503808-108503830 GAGCAAAATTTACAATTTAATGG + Intergenic
1090540010 11:127691152-127691174 GTGCAGACTGTCCTTTTCAAGGG - Intergenic
1090954235 11:131500268-131500290 GAACAGGTTGTACATTTTACTGG + Intronic
1092181270 12:6448470-6448492 GAGCAAAATGTATATTTTAAAGG + Intronic
1093087967 12:14887680-14887702 GAGTAGACTACTCATTTTAAGGG - Intronic
1093288542 12:17296456-17296478 GAGCAGTGTAAACATTTTAATGG + Intergenic
1094704606 12:32902178-32902200 GAGCAGAAAGAATATTTTAATGG + Intergenic
1096136052 12:49202317-49202339 GAGCAGAGTGGACATTGTGATGG + Intronic
1100903801 12:99274302-99274324 GAACAGACTGTTCATTACAAAGG - Intronic
1101043998 12:100785992-100786014 AAGCAGAATGAGCATTTTAAAGG - Intronic
1101095539 12:101335590-101335612 GAGCTGAATGTACATTTAGATGG - Intronic
1104560184 12:129836235-129836257 GAGCAGACAGAGCTTTTTAAAGG - Intronic
1108007046 13:45959318-45959340 AAGCATATTATACATTTTAATGG + Intronic
1109127115 13:58531289-58531311 GGGGAGGCTTTACATTTTAAAGG + Intergenic
1109903602 13:68808140-68808162 GCACAAACTGTAAATTTTAATGG + Intergenic
1111049764 13:82865856-82865878 GAGCAGACTGTAAATTCAAGTGG - Intergenic
1111194255 13:84851672-84851694 CAGCAGACAGACCATTTTAATGG + Intergenic
1111934591 13:94546369-94546391 GAGGTGACTGGGCATTTTAAGGG - Intergenic
1116641441 14:47468887-47468909 GAGCAGGTTTGACATTTTAAAGG - Intronic
1119782009 14:77282132-77282154 GACCAAACTGTACAATTTGAAGG - Intronic
1124255003 15:28133113-28133135 GAACAGGTTTTACATTTTAACGG + Intronic
1126116710 15:45214900-45214922 GAACAAACTGTACATGTGAAGGG - Intergenic
1126217334 15:46171349-46171371 TAGCACACTCTACATTTAAAAGG - Intergenic
1127021670 15:54755533-54755555 AAACAGACTGTATATTTTCAAGG + Intergenic
1127675061 15:61230192-61230214 GATGAGACTGTACATTTAATAGG - Intergenic
1128536779 15:68497605-68497627 GAGCAGACATAACATTTTATAGG + Intergenic
1130003938 15:80076164-80076186 TAGCATACTATACATATTAATGG + Intronic
1130735650 15:86545771-86545793 GAGGAGAATGTAGACTTTAAGGG - Intronic
1136048389 16:27633249-27633271 GCCCTGACTGTACATTTAAATGG + Intronic
1136141243 16:28290181-28290203 GAGCAGGCTCTAAATGTTAAGGG + Intergenic
1139869362 16:70092758-70092780 GAGGAGATTTTTCATTTTAAAGG + Intergenic
1140386021 16:74539455-74539477 GAGGAGATTTTTCATTTTAAAGG - Intronic
1141241272 16:82267223-82267245 CACCAGCCTGTACATTTGAATGG + Intergenic
1141331252 16:83113512-83113534 GGGCAGACTCTACATTTTCCTGG - Intronic
1141613527 16:85197348-85197370 GAGCAGGCAGTTAATTTTAAAGG + Intergenic
1146364114 17:32205511-32205533 GAGTAGCCTATACATTTTTAAGG - Intronic
1147415024 17:40282593-40282615 GACCAGATTATACATTTTAGAGG - Exonic
1151073003 17:71238191-71238213 AAGCATAGTGCACATTTTAATGG + Intergenic
1155338448 18:24789683-24789705 GAACAGAATGGACATTTTGAAGG - Intergenic
1155779148 18:29809382-29809404 TAGCAGACTGGACATTTCACAGG + Intergenic
1156757844 18:40550322-40550344 GAGCATAGTGTTCATTTTAGTGG - Intergenic
1163999659 19:21085681-21085703 GAGCAGACTGGACATCTGCAGGG - Intronic
1164014888 19:21246085-21246107 GTTCAGACTGTACTTTTTGAGGG - Intronic
1164818942 19:31229102-31229124 GAGAAGACTAAACATTGTAAGGG + Intergenic
1165564491 19:36712899-36712921 TAGCAGAATGTAAATTTAAAAGG + Intronic
925239702 2:2313310-2313332 GTGGAGACAGCACATTTTAAGGG - Intronic
925623705 2:5820486-5820508 GACCAAACTGTACAATTGAAAGG - Intergenic
928709953 2:33992915-33992937 GGGCAGTATGGACATTTTAATGG - Intergenic
929212091 2:39368277-39368299 GAGCACGGTGTAGATTTTAAGGG + Intronic
929373766 2:41259064-41259086 GAGCAGAGTATACATTTCTAGGG + Intergenic
929638425 2:43549145-43549167 GGGCATTCTGTACATTTTACTGG + Intronic
930570955 2:53086496-53086518 GAGAATACTGTAGATTTTAATGG - Intergenic
930875199 2:56207349-56207371 GAGCATACTCTACATTTGACTGG + Intronic
933295909 2:80491224-80491246 GAGCAGACTTTAAATGGTAAAGG + Intronic
933781165 2:85802374-85802396 GAGCAGAATCTCTATTTTAATGG + Intergenic
941203550 2:162544185-162544207 GAGCACAGTGTGCTTTTTAAAGG - Intronic
942273195 2:174297674-174297696 GAGTAGAGGATACATTTTAAGGG + Intergenic
942455387 2:176134967-176134989 GAGGAGAGAGAACATTTTAATGG + Intergenic
942490029 2:176480772-176480794 GAGGAGAGTGAACTTTTTAATGG + Intergenic
942895331 2:181046614-181046636 TTGCACACTGTACAGTTTAAGGG - Intronic
944922896 2:204434006-204434028 AAGCAGACTGTAAGTTTCAAGGG + Intergenic
944974219 2:205029538-205029560 TAGCAGACTGAACATTTTAGTGG - Intronic
946475365 2:220001583-220001605 GAGCAGGCAGTATATTTTAAAGG + Intergenic
947464953 2:230335375-230335397 GAAAACACTGTACATTATAAAGG - Intronic
1169777994 20:9276997-9277019 AATCAGACTGGTCATTTTAATGG + Intronic
1173305974 20:41850060-41850082 GAGAAAACTGTACATTATGAAGG - Intergenic
1173449361 20:43148780-43148802 TAGCAGACAGTACATTTTTGAGG - Intronic
1173982686 20:47236977-47236999 GGGGTGACTGGACATTTTAAAGG - Intronic
1174896334 20:54453368-54453390 GAGGTGACTGGACATTTTAAAGG - Intergenic
1175744786 20:61448356-61448378 GAGCAGAATGTAGAAATTAATGG + Intronic
1176262814 20:64191647-64191669 GGCGAGAATGTACATTTTAATGG + Intronic
1177871599 21:26579546-26579568 CAGCAGAATGGTCATTTTAACGG + Intergenic
1178615678 21:34130922-34130944 GAGCAGTGTTTACATTTTAAAGG - Intronic
1178692752 21:34763411-34763433 GAGGTAACTGCACATTTTAAAGG + Intergenic
1178832253 21:36065770-36065792 GAGATGACTGTGCCTTTTAAAGG - Intronic
1179188437 21:39103338-39103360 GTGCACATTGTACATTTTATGGG - Intergenic
949847729 3:8389031-8389053 CAGCAGACTGCTCATATTAATGG - Intergenic
951160340 3:19411930-19411952 GGGCAGTATGAACATTTTAATGG - Intronic
951596137 3:24320284-24320306 GAGCAGACAATACATTTTTCTGG - Intronic
951652800 3:24970030-24970052 GAGCAGACAGTACATATTTTAGG + Intergenic
953004487 3:38965481-38965503 GAGCAGACTGTCGATTGTGAAGG - Intergenic
953577840 3:44127573-44127595 CAGCAGCCTGTACGGTTTAAAGG - Intergenic
955432968 3:58869327-58869349 AAGCAGACTGTACCTATTCATGG - Exonic
956264873 3:67385490-67385512 GAGCTGACTGAATATTTGAATGG + Intronic
956867626 3:73385019-73385041 GGGCAGGCTGTACATTTCTAAGG + Intronic
961390423 3:126549388-126549410 GAGCTGCCTCTACATTTGAATGG + Intronic
961930137 3:130524267-130524289 GAGCTGTCTGCACATTTTAAGGG + Intergenic
964087759 3:152837165-152837187 GAAAAGCCTGCACATTTTAAAGG - Exonic
964249034 3:154688995-154689017 GAACAGATTGTACATTTCTATGG - Intergenic
966242120 3:177766254-177766276 GAGCAGTCTGCCCATTTTAAAGG + Intergenic
966397071 3:179515060-179515082 TAGCATACTGTAAATATTAATGG - Intergenic
966666605 3:182478625-182478647 GAGCAGACAGTAAAATATAATGG - Intergenic
970962612 4:21890555-21890577 AAGCTGCCTGTACATTTTTAAGG - Intronic
971327769 4:25658130-25658152 GAGGATACTGTTCATTTTAAAGG + Intronic
971906715 4:32735768-32735790 GAGCAAACGGTACATTTTCCTGG - Intergenic
972921162 4:43943495-43943517 GTGTAGAGTGTACATTCTAATGG + Intergenic
973213870 4:47647221-47647243 GAGCAGACTGTACCATTTGGCGG - Intronic
973707874 4:53597887-53597909 AACCAGACTGGACATTTTTATGG + Intronic
976621570 4:87133677-87133699 TAGCAGAATGTACATTTGCAAGG - Intronic
976981552 4:91238006-91238028 GAGCACACTGCTCATTTTAATGG - Intronic
978633760 4:110779169-110779191 GAGCAGACTTCACTTCTTAAAGG + Intergenic
978862733 4:113470251-113470273 GAGAAGACAGTACATATAAAGGG - Intronic
979706857 4:123730588-123730610 GGGCAGTATGGACATTTTAATGG + Intergenic
981107082 4:140893230-140893252 GAGCAGACTGTAATTTCTCAGGG + Intronic
983788626 4:171765421-171765443 GAGATGACTGGGCATTTTAAAGG - Intergenic
983939944 4:173528069-173528091 AATAAGCCTGTACATTTTAAGGG - Intronic
986232589 5:5880281-5880303 CAGAAGACTGAGCATTTTAAGGG + Intergenic
987178074 5:15337356-15337378 GAGCAACCTGGACATTTTATAGG - Intergenic
991740302 5:69665448-69665470 GAGCACAATGTACATTTTTCAGG + Intergenic
991791877 5:70245189-70245211 GAGCACAATGTACATTTTTCAGG + Intergenic
993083209 5:83328527-83328549 GAGCAAATTGTAAAATTTAAAGG + Intronic
997145685 5:131430646-131430668 CATCAGACTTTTCATTTTAATGG + Intronic
997361221 5:133296381-133296403 GATCTGACTTTATATTTTAAAGG - Intronic
999626510 5:153526359-153526381 AAGCAAAATGTATATTTTAAAGG + Intronic
999888161 5:155946890-155946912 GAGAATATTGAACATTTTAAGGG + Intronic
1003221323 6:4163517-4163539 GAGCTGACTCTATATTTAAAAGG - Intergenic
1007366353 6:41396713-41396735 GAACTCACTGTCCATTTTAATGG - Intergenic
1008116854 6:47561171-47561193 CATCAGATTGTATATTTTAAAGG - Intronic
1008551405 6:52635636-52635658 GAACAAATTATACATTTTAAGGG - Intergenic
1008973559 6:57398603-57398625 GAGAAGAATGTATATTTTATTGG + Intronic
1009508285 6:64514494-64514516 CAGAAGACTTTATATTTTAATGG + Intronic
1011249360 6:85354370-85354392 GATCACTCTGGACATTTTAAAGG + Intergenic
1013678671 6:112497058-112497080 AAGCAGTTTGTACATTTTATTGG - Intergenic
1013728801 6:113137286-113137308 CAGCAGACCGTACATTTTAATGG + Intergenic
1016787203 6:148023990-148024012 GATCAAACTGTACACTCTAAAGG - Intergenic
1021181188 7:17507907-17507929 CAGCAGAGTGTACATTGGAATGG - Intergenic
1023100222 7:36710286-36710308 GAGAAAACTCTACATTTAAAGGG - Intronic
1025738910 7:64180902-64180924 GTGGAAACTGTTCATTTTAATGG + Intronic
1027844897 7:83360446-83360468 GAACACACTGTACATCTTATGGG - Intergenic
1028260410 7:88657524-88657546 GACCAAACTGCAGATTTTAAAGG + Intergenic
1028716220 7:93972887-93972909 GAGGAAACTGTACATTTCAGTGG + Intronic
1031350654 7:120726777-120726799 GAGCATTCTGTACATTGTATAGG - Intronic
1031863057 7:127005220-127005242 GAGCAGAATGTAAATATTTATGG - Intronic
1038281163 8:26166299-26166321 GAACAGAAAGTACATTTTAAAGG + Intergenic
1038698697 8:29829384-29829406 GATAAGACTCTACATTTTATGGG + Intergenic
1039445160 8:37625247-37625269 ATCCAGAATGTACATTTTAATGG + Intergenic
1039683086 8:39763884-39763906 GAGCTCACTGGAAATTTTAAAGG + Intronic
1040823971 8:51597489-51597511 GAGCAGAATGTCCATTTTAGCGG + Intronic
1042777903 8:72454897-72454919 GGGCAGTATGGACATTTTAACGG + Intergenic
1043910653 8:85859552-85859574 GAGCTGACAGTATATTTGAAAGG + Intergenic
1044575123 8:93760092-93760114 TACCAGTCTGTATATTTTAAAGG + Intronic
1051448387 9:17166424-17166446 GAGAAAAATGGACATTTTAAAGG + Intronic
1051983327 9:23050884-23050906 GAAAAGACTTTACTTTTTAAAGG - Intergenic
1053507083 9:38652212-38652234 AAGCAGAATGTACATTTTACAGG - Intergenic
1055098003 9:72434308-72434330 GATCAGAATCTGCATTTTAATGG - Intergenic
1055234781 9:74107728-74107750 GAAAACCCTGTACATTTTAATGG + Intergenic
1055325874 9:75128961-75128983 AAGAAGCCTGTACATTTCAATGG - Intronic
1055535806 9:77242885-77242907 GAACAGACTTCAAATTTTAAAGG - Intronic
1057346484 9:94255704-94255726 CAGCAGACTGGACATTTCAGGGG - Intergenic
1057875832 9:98753949-98753971 GAGCCGACTGTTCAGTTTATAGG - Intronic
1186193197 X:7086127-7086149 GAGGTGACTGGGCATTTTAAAGG - Intronic
1186827795 X:13358849-13358871 GACCAGACTCTAAATTTTTATGG - Intergenic
1188396886 X:29695896-29695918 GACCACACTTTACATTTTAATGG + Intronic
1188572643 X:31606950-31606972 GTGCAGACTGAGCATTTTCACGG + Intronic
1189131974 X:38508686-38508708 GAACAAACTGTACACTTAAATGG - Intronic
1189943196 X:46149456-46149478 TAGCAGAATATACATTTTTAAGG - Intergenic
1190108685 X:47575730-47575752 GAGCAGACGGTACATATTTTAGG - Intronic
1192166078 X:68828520-68828542 AAGCAGACAGTGCATTTTGAGGG + Intergenic
1192746877 X:73948048-73948070 GAACAGAGTGGACATTTAAAGGG + Intergenic
1194007257 X:88510406-88510428 GATAAGACTGAAGATTTTAAGGG - Intergenic
1194572572 X:95571543-95571565 GAGAATAATGTACAATTTAATGG + Intergenic
1195087751 X:101428720-101428742 GAATAAACTGTACATTTGAAGGG - Intronic
1195309449 X:103616543-103616565 GTGCAGACCCTACAGTTTAAGGG - Intronic
1197170088 X:123423304-123423326 GCACATACTTTACATTTTAAAGG - Intronic
1199019758 X:142864494-142864516 GAGCTTTCTGTACTTTTTAAAGG - Intergenic
1199089843 X:143678923-143678945 GAGGTGAATGTACATTTTATTGG + Intergenic