ID: 1068714458

View in Genome Browser
Species Human (GRCh38)
Location 10:60172993-60173015
Sequence CCCATTCTGTAGAAGGAAGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 239}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068714454_1068714458 8 Left 1068714454 10:60172962-60172984 CCTGCTGTGCTGCTTGATGTAAT 0: 1
1: 0
2: 0
3: 10
4: 134
Right 1068714458 10:60172993-60173015 CCCATTCTGTAGAAGGAAGATGG 0: 1
1: 0
2: 1
3: 19
4: 239
1068714453_1068714458 9 Left 1068714453 10:60172961-60172983 CCCTGCTGTGCTGCTTGATGTAA 0: 1
1: 0
2: 0
3: 25
4: 245
Right 1068714458 10:60172993-60173015 CCCATTCTGTAGAAGGAAGATGG 0: 1
1: 0
2: 1
3: 19
4: 239
1068714452_1068714458 10 Left 1068714452 10:60172960-60172982 CCCCTGCTGTGCTGCTTGATGTA 0: 1
1: 0
2: 0
3: 15
4: 157
Right 1068714458 10:60172993-60173015 CCCATTCTGTAGAAGGAAGATGG 0: 1
1: 0
2: 1
3: 19
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068714458 Original CRISPR CCCATTCTGTAGAAGGAAGA TGG Exonic
902607725 1:17578118-17578140 CCCATTTTACAGAAGGAAAAAGG - Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
909237465 1:73171843-73171865 CCCTTTCAGCAGAAGGAGGAAGG - Intergenic
909248295 1:73318748-73318770 CCCATTTTGTAGACTGAGGAAGG + Intergenic
911387660 1:97196973-97196995 CTCATACTGTACAAGTAAGAAGG - Intronic
912090585 1:106069956-106069978 CCCATTCTGTAAATGTAAGTTGG + Intergenic
914978385 1:152388998-152389020 CCCAAACAGTAGAAGGGAGAAGG + Intergenic
915476076 1:156153681-156153703 GCCATTCAGGAGAAAGAAGAAGG - Exonic
915593252 1:156882434-156882456 CCCATTCTGTCCAAGGGAGTAGG + Intergenic
915964453 1:160294291-160294313 CCCATTTGAAAGAAGGAAGATGG - Intronic
916298662 1:163248954-163248976 CCCATTATGAAGCAGGCAGAGGG - Intronic
916676484 1:167068143-167068165 TCAATTATGTAAAAGGAAGAGGG + Intronic
917301556 1:173579957-173579979 TCCATTTTTTAGAAGGAAAAGGG + Intronic
918007164 1:180552581-180552603 CTCTTTCTCTAGAGGGAAGATGG - Intergenic
918035167 1:180863691-180863713 CTCGTTCTGAAGAAAGAAGAGGG - Exonic
919937500 1:202264396-202264418 CCCTTTCTGGAGAAGCAAGTCGG + Intronic
920442067 1:205987758-205987780 TACCTTCTGTAGAAGGAACAGGG + Intronic
922360505 1:224817351-224817373 ACCATTCTGTAGAAGGATCTTGG - Intergenic
923544408 1:234913851-234913873 CCCATTCTGCATATGAAAGAGGG + Intergenic
924736689 1:246763440-246763462 CCCATTATTTAAAGGGAAGAAGG - Intronic
1064115951 10:12577669-12577691 GACAATCTGTAGCAGGAAGAGGG - Intronic
1064497597 10:15929875-15929897 TACATTCTGGAGGAGGAAGATGG + Intergenic
1066228834 10:33412029-33412051 CCCATTCTCCTGAAGAAAGATGG + Intergenic
1068714458 10:60172993-60173015 CCCATTCTGTAGAAGGAAGATGG + Exonic
1068948233 10:62750998-62751020 TCCCATCTGTAGAAGGAAGGAGG + Intergenic
1069690918 10:70351433-70351455 CTCATTCTATGGAAGGAGGAGGG - Intronic
1069702716 10:70438451-70438473 CCCTCTCTGTAAAAGGGAGATGG + Intronic
1069800451 10:71078532-71078554 GCCAACCTGTATAAGGAAGAAGG + Intergenic
1069986449 10:72287432-72287454 CCCATCCTGTAGAAGGGAGGTGG - Intergenic
1070343810 10:75522662-75522684 CCCATGTTGTAGAACAAAGAAGG - Intronic
1070797627 10:79226094-79226116 CCCATTCTGTGGGTGGGAGATGG + Intronic
1071318046 10:84422132-84422154 CTCACTTTGCAGAAGGAAGAAGG + Intronic
1073691835 10:105818206-105818228 AACATTCTGTACAAGGAAGATGG + Intergenic
1074341831 10:112638957-112638979 CCCATTTTGTAGAAAGAAACAGG - Intronic
1076443001 10:130493065-130493087 CCCAGGCTGCAGCAGGAAGAGGG - Intergenic
1076755256 10:132567225-132567247 CACATTCTGCAGAAGCAGGAAGG + Intronic
1078581924 11:12545451-12545473 CCTATTCTGTAGACGAAAGAAGG - Intergenic
1078705190 11:13737058-13737080 ACCATCCTGTAGGAGGAAAATGG + Intergenic
1079104765 11:17563480-17563502 GCCATTCTCTAGCAGAAAGAAGG - Intronic
1081296667 11:41398546-41398568 CCCCTTTTGAAGAAGGAAGAGGG + Intronic
1082068288 11:47918342-47918364 ACCATTCTGGAGTTGGAAGAGGG + Intergenic
1082068619 11:47920684-47920706 ACCTTTCTGTAGTTGGAAGAGGG + Intergenic
1082107754 11:48238904-48238926 CTAATACTATAGAAGGAAGAAGG + Intergenic
1083326736 11:61876772-61876794 CCCATTCTGCAGACGGGAAAAGG + Intronic
1084136880 11:67190443-67190465 CCAATTCTGTAGAAATAAAAAGG + Intronic
1084769239 11:71331930-71331952 CCCCTCCTGTAGAAGGAGAATGG + Intergenic
1084783953 11:71430774-71430796 CTCATTCAGTAGAGGGGAGACGG - Intronic
1085286277 11:75363775-75363797 CCCTTTCTGATGAAGGAAGCTGG - Intergenic
1086400136 11:86454601-86454623 CCCAATCTGTAAAATGAGGATGG - Intronic
1088347942 11:108850886-108850908 CCCATTCTATAGATGAAAAATGG - Intronic
1088545785 11:110957325-110957347 CCCATTCTATAGAAGGTAGTGGG + Intergenic
1089234309 11:117010144-117010166 CCCATTGTGAATAAGGAAGAGGG - Intronic
1089350454 11:117818998-117819020 CCCCTTCTGTAAATTGAAGACGG + Intronic
1089700613 11:120241788-120241810 CCCATTCTGTGGAAGTGGGAGGG + Intronic
1089860950 11:121589628-121589650 CACATTATGTATAAGGAAGGTGG + Intronic
1090156211 11:124441167-124441189 CCTATTCTCAAGAAGGAAGGAGG - Intergenic
1092188772 12:6502087-6502109 CTGATGCTGCAGAAGGAAGAGGG + Intronic
1093789707 12:23234395-23234417 CCCAGTCTGGACAAGGGAGATGG + Intergenic
1095289216 12:40457483-40457505 CCCATTCTCTATAAGAAAAATGG + Intronic
1096290262 12:50336282-50336304 CCTCTTCTGTAGAATGAGGATGG - Intronic
1097361642 12:58665065-58665087 AGCATCCTGTAGAAGGAATATGG - Intronic
1100839558 12:98598672-98598694 CCCAAAATGTATAAGGAAGAAGG + Exonic
1101013171 12:100472224-100472246 CCCCTTCGGCACAAGGAAGAGGG - Intergenic
1101203323 12:102459736-102459758 GTCATTCTGGTGAAGGAAGAAGG - Intronic
1102326910 12:111993589-111993611 CCCAAGATGTATAAGGAAGAAGG + Intronic
1107328531 13:39271858-39271880 CCCCTTCTGGAGAAGGGAGATGG - Intergenic
1107852935 13:44589303-44589325 TCCATTCTCAAGAAGGAACATGG + Intergenic
1108394685 13:49980855-49980877 CCCATTGTGTGGAAGGAAGATGG - Intergenic
1108853238 13:54761875-54761897 CCCATGCTGTGGAACCAAGAAGG + Intergenic
1109749853 13:66675756-66675778 ACCATTCTGAAGAAAGATGAAGG - Intronic
1110199708 13:72834246-72834268 CACATCCAGTAGAAGAAAGAAGG - Intronic
1117028171 14:51642701-51642723 GCATTTCTGTAGGAGGAAGATGG + Intronic
1118915709 14:70101836-70101858 CCTATTGTGGAGCAGGAAGATGG + Intronic
1119174590 14:72559849-72559871 CCCATTCTGTAGAAAGGGGAAGG + Intronic
1120205936 14:81587820-81587842 CGAATTATGTAGAAGGAGGAGGG - Intergenic
1121553909 14:94822114-94822136 CCGAAGCTGTAGAGGGAAGATGG + Intergenic
1126921755 15:53534403-53534425 CCCCTTCTGTTGTAGGGAGAAGG - Intronic
1127911787 15:63422298-63422320 CAAATTGTGTTGAAGGAAGAGGG - Intergenic
1127965844 15:63922448-63922470 CCCCTTCTGCAGAGGGAGGATGG - Intronic
1128086780 15:64892071-64892093 CCCTTTCTGTAAAAGCAGGAGGG - Intronic
1128256533 15:66201306-66201328 CACATTCTGCAGGAGGAGGAAGG - Intronic
1128768572 15:70265716-70265738 CTCATTCTGGAGAATGGAGAAGG + Intergenic
1130743409 15:86625228-86625250 CCCAATCTGTAAAATGAAGGTGG + Intronic
1130837358 15:87663934-87663956 ACCAGTCTGGAGAAGGAAGGAGG - Intergenic
1130873416 15:87991070-87991092 CACATTCTGTGGAATGAACAAGG - Intronic
1130907632 15:88251675-88251697 CCAACTCTGTAGAAGGACCAGGG - Intronic
1132193715 15:99893169-99893191 CCAATTCTGTAGAATAAAGCTGG + Intergenic
1132703065 16:1230172-1230194 CCCACTGGGTAGAAGGAACAGGG - Exonic
1132705257 16:1240696-1240718 CCCACTGGGTAGAAGGAACAGGG + Exonic
1133097802 16:3458812-3458834 CCCAATCTGGAGAAGAAAGTCGG - Intronic
1136705369 16:32183628-32183650 CACATTTTGTAGTAAGAAGAGGG - Intergenic
1136762544 16:32745779-32745801 CACATTTTGTAGTAAGAAGAGGG + Intergenic
1136805555 16:33124607-33124629 CACATTTTGTAGTAAGAAGAGGG - Intergenic
1139431321 16:66912425-66912447 CCCAATCTGGAGGAGGAGGAGGG + Exonic
1140696874 16:77543421-77543443 CCCTGTCTGTAGAAGGAGGAAGG + Intergenic
1141890298 16:86922066-86922088 CCAATTCTGGGGAAGGAGGAAGG + Intergenic
1203064700 16_KI270728v1_random:1006098-1006120 CACATTTTGTAGTAAGAAGAGGG + Intergenic
1142831685 17:2553840-2553862 CCCTGTCTGTCGGAGGAAGACGG - Intergenic
1143280538 17:5751105-5751127 CCTATGCTGTAAAAGGGAGATGG + Intergenic
1144373841 17:14619394-14619416 CCCAGTCTGCTGAAGCAAGAGGG + Intergenic
1144784095 17:17822465-17822487 CCCAGTCTGTATGAGGAGGAAGG - Intronic
1145795448 17:27652975-27652997 CCCATTTTGCAGAGGGAAGGGGG - Intergenic
1150044799 17:61901896-61901918 CCCATTCTGAAGGAGCAAAATGG - Intronic
1152323774 17:79623935-79623957 TCCATCTTGAAGAAGGAAGAGGG + Intergenic
1153314522 18:3708851-3708873 CACATTAGGTGGAAGGAAGAAGG + Intronic
1153437125 18:5079459-5079481 CCCATTATGGAGGAGGTAGAGGG - Intergenic
1154064826 18:11096921-11096943 CCTATCCTGGAGAAGGAAGCTGG + Intronic
1154103032 18:11494043-11494065 CCCTATCTGTGGAATGAAGAAGG + Intergenic
1154974077 18:21439948-21439970 CCCATTTTGTAAAAGGAGAAAGG - Intronic
1157490156 18:48117540-48117562 CCCATTCTATAGATGAAAAAAGG - Intronic
1160556323 18:79727699-79727721 CCCATCCTGGTGAAGGAAAACGG - Intronic
1161487209 19:4542885-4542907 CCCACTCTGCAGAGGGAAGCGGG - Exonic
1162319506 19:9962818-9962840 CACATTCCGTCGAGGGAAGAAGG - Exonic
1162658618 19:12151968-12151990 CACATTCTGTAGCAACAAGAGGG + Intronic
1162769435 19:12940226-12940248 ATCATCCTGAAGAAGGAAGAAGG - Exonic
1166437460 19:42780528-42780550 CCCATACTGCAGATGGTAGATGG + Intronic
1166493267 19:43278253-43278275 CCCATACTGCAGATGGTAGATGG + Intergenic
1167360882 19:49029800-49029822 CCCACTCTGGAGGAGGAAAAGGG - Intronic
1167421288 19:49404990-49405012 CTCATTCTGTGGAAGAAAGCAGG - Intronic
1168182316 19:54670721-54670743 CCCTTTCTGTAGGAGGAGGATGG - Intronic
1168193538 19:54756972-54756994 TTCAGTCTGTAAAAGGAAGATGG + Intronic
1168195601 19:54771710-54771732 TTCAGTCTGTAAAAGGAAGATGG + Intronic
927197195 2:20556365-20556387 CCCATTCTGTAAGAAGAAAATGG + Intergenic
927203062 2:20590421-20590443 CCTTCTCTGTAGAAGGATGATGG + Intronic
927318917 2:21720109-21720131 CCCCTTCTGCAGAAGGGAGCTGG - Intergenic
927393727 2:22625508-22625530 CCCATTTTACAGAAGGAAAATGG + Intergenic
927947969 2:27148848-27148870 CCCATGCTGAAGAAGGCAGGAGG - Intergenic
929523712 2:42679683-42679705 GCCATTCTTTAAAATGAAGAAGG - Intronic
930960490 2:57254148-57254170 CCCTTTCTGTACAAGGCAGCAGG - Intergenic
931319718 2:61164339-61164361 CCCATTCTCTTGCAGGATGATGG + Exonic
932096999 2:68859592-68859614 CCCATGCTGTGCAAGGAAGTGGG + Intergenic
933689879 2:85171777-85171799 CCCATTCTGGAGATGCAAGATGG - Intronic
935573919 2:104689579-104689601 CCCATTTCGTAGAAGTCAGAGGG + Intergenic
941370302 2:164656562-164656584 CCCATTCCCTAGAGGGAAGTGGG - Intronic
941936290 2:170983632-170983654 GCCATTTTGTAGGTGGAAGAGGG - Intergenic
943201414 2:184830753-184830775 TCCATTCTCTAGGAGGAGGAAGG - Intronic
944277687 2:197857992-197858014 CCCATGATGTAGGAGTAAGAGGG - Intronic
945316223 2:208373577-208373599 CTCATACTGTTGGAGGAAGAGGG + Intronic
946115977 2:217462645-217462667 CCCATGCTGTAGTGGCAAGATGG + Intronic
947026383 2:225742488-225742510 CCCACTCTGATGAAAGAAGATGG - Intergenic
948695855 2:239732717-239732739 CCCAGTCAAAAGAAGGAAGAAGG + Intergenic
948952862 2:241265814-241265836 CCCTTTCTAGAGAGGGAAGACGG - Intronic
1169475666 20:5929154-5929176 CCCATTATGAAGAAGAAAGATGG - Intergenic
1170914333 20:20607985-20608007 ACCATTTTCTAAAAGGAAGAGGG + Intronic
1172701421 20:36855775-36855797 CCCATTTTACAGGAGGAAGACGG + Intronic
1173141939 20:40492206-40492228 CCCACTCTGTAAAATGAAGGTGG + Intergenic
1173197428 20:40927473-40927495 TTGATTCTGTAGAAGGAAAAGGG + Intergenic
1173756288 20:45519303-45519325 TCTCTTTTGTAGAAGGAAGAAGG + Intergenic
1174181264 20:48676467-48676489 CCCACTCTGTAGGTGGAAGGAGG - Intronic
1174516804 20:51098862-51098884 CACATTCTGTAGAATGATGGAGG + Intergenic
1178894742 21:36549078-36549100 CTCATTCTGTAGAAGGTTGTTGG - Intronic
1181540783 22:23572206-23572228 CCCACTCAGTATCAGGAAGATGG + Intergenic
1182086381 22:27563917-27563939 CCCCATCTGTAAAATGAAGAGGG + Intergenic
1184624272 22:45711081-45711103 CCCATTTTTAAGAAGGAAGTAGG - Intronic
1185167888 22:49272893-49272915 CCCATGCAGCAGAAGGAGGAGGG + Intergenic
949566975 3:5253957-5253979 CCCATTATGGAGAAGGCAGGTGG + Intergenic
949716728 3:6940712-6940734 TCTATTTTGTAGAAGGAACAAGG + Intronic
950114091 3:10439186-10439208 CCCATTCTGTAGACATCAGATGG - Intronic
952928929 3:38344895-38344917 CTCACTCTGTAAAATGAAGATGG + Intergenic
953023155 3:39128819-39128841 CCAGCTCTGAAGAAGGAAGAAGG + Exonic
953420527 3:42750254-42750276 GCCTTACTGGAGAAGGAAGATGG - Intronic
953884862 3:46709448-46709470 CCTATTCTCCAGTAGGAAGAAGG + Intronic
954002374 3:47567709-47567731 CCCCATCTATAAAAGGAAGAAGG + Intronic
954989235 3:54825255-54825277 CCTTCTGTGTAGAAGGAAGAAGG - Intronic
955081838 3:55664961-55664983 CCCATTATTTATAAGGAATAAGG - Intronic
958489944 3:94759772-94759794 CATATTCTGGAAAAGGAAGATGG + Intergenic
959188671 3:103081674-103081696 CTAATTCTGTAGATGGAAGATGG - Intergenic
960576309 3:119233246-119233268 CCCACTCTGTAGAATGAGGGAGG - Intronic
962133218 3:132705121-132705143 CCCATTCTGTTTGAGGGAGAGGG + Intronic
962753667 3:138452222-138452244 GCCATTCTGGTGAAAGAAGAGGG - Intronic
963482178 3:145890018-145890040 GCCAGACTGTAGCAGGAAGAAGG + Intergenic
963541675 3:146598773-146598795 TCCTTTCTGCAGATGGAAGATGG + Intronic
965071794 3:163924294-163924316 TCCCTGCTGTAGAAGGAAGTAGG + Intergenic
965440268 3:168704032-168704054 CCCATTCTGGATTTGGAAGAGGG + Intergenic
966125664 3:176573252-176573274 CACATTCTGTAACAGGAAGAGGG + Intergenic
966905730 3:184524821-184524843 CTCATTCTGTAAAAGGCACAAGG - Intronic
967925005 3:194639119-194639141 TCCTTTCTGTAAAAGGAGGAAGG + Intergenic
969312539 4:6362290-6362312 CCCATCCTGAAGAGGGAAGCAGG + Intronic
971882080 4:32389698-32389720 CAAAATCTGTGGAAGGAAGAAGG + Intergenic
972409042 4:38773609-38773631 CCCAATCTAGAGAAGGAAGATGG - Exonic
974617536 4:64308208-64308230 CCCATTATGTAGCTGGCAGAAGG + Intronic
974746308 4:66082459-66082481 CCCAAGCTGGAGAAGGAGGAAGG + Intergenic
975826520 4:78325601-78325623 CCCATGCTATAAAAGCAAGAAGG - Intronic
977235542 4:94503468-94503490 CTCATCGTGTAGTAGGAAGATGG + Intronic
978740862 4:112136378-112136400 CTCATTTGGCAGAAGGAAGAAGG + Intergenic
979346213 4:119590517-119590539 TCCATTCTCTAGAAGGGAGTAGG + Intronic
979862949 4:125717169-125717191 CACATTTTGTAGAAGTGAGAAGG + Intergenic
979991214 4:127378032-127378054 CCAATTCTGTAGGATGAATATGG + Intergenic
979993934 4:127408527-127408549 CTCATCCTGTGGAAGGAAGATGG + Intergenic
982713578 4:158783339-158783361 ACCATTCTGTACAAGGCACAGGG + Intronic
983247217 4:165301720-165301742 CACATTATTTAGAAGGAAGTTGG - Intronic
983897287 4:173095240-173095262 CTCACTCTCTAGAAGGAAGTAGG + Intergenic
988435906 5:31175137-31175159 TCCATGATGGAGAAGGAAGAGGG + Intergenic
991410771 5:66343362-66343384 CTCCTTGTGTAGCAGGAAGAGGG + Intergenic
991718019 5:69469903-69469925 CCTATTCTGGAGAGGGATGAAGG - Intergenic
992399322 5:76397308-76397330 CCCATTCTGTAAAGGAAAAAAGG - Intergenic
994431828 5:99675809-99675831 ATCAATCTGTAGAAGGAATAAGG - Intergenic
994549370 5:101210890-101210912 CCCATTGTGTAGCTGGGAGAAGG - Intergenic
999926139 5:156380392-156380414 CCCCTTCTGTTGTAGGAGGAAGG - Intronic
1000380730 5:160627067-160627089 GACAATCTGTAGAAGCAAGATGG - Intronic
1002720631 5:181259432-181259454 GCCTTTCTCTAGAAGGAAAACGG + Intronic
1003247427 6:4395451-4395473 CCCAATCTGTAAAAAGATGATGG - Intergenic
1003892268 6:10574123-10574145 TCCATTCTGTAGAAGAAGAAAGG + Intronic
1007296228 6:40823469-40823491 CCCATTCTGTAGGTTGAGGAGGG - Intergenic
1010327011 6:74576097-74576119 CCCATTGTTTAGAAGGGTGATGG + Intergenic
1010431308 6:75781466-75781488 CCCATTCTGTAACAGTGAGAGGG + Intronic
1012754401 6:103206630-103206652 CCCATTTTGTAAAAAGAACATGG - Intergenic
1013006338 6:106077717-106077739 CCCATTCTTTAGAAGACAGAAGG - Intergenic
1013198032 6:107863294-107863316 CCCACTCAGTAGAAAAAAGAGGG + Intergenic
1013219724 6:108067471-108067493 CCCATCTTGGACAAGGAAGAAGG + Intronic
1014387266 6:120817912-120817934 ACAATGCTGTAGAAGGAGGAGGG + Intergenic
1015445891 6:133304354-133304376 CCCACTCTGTTTCAGGAAGATGG + Intronic
1015894630 6:138005045-138005067 CCCATTCTGTAGGTGTAAGGTGG - Intergenic
1016540728 6:145160797-145160819 GCAATTCTGTAGAAAGAAAATGG + Intergenic
1017632779 6:156413700-156413722 CTCATTTTGAAGATGGAAGACGG + Intergenic
1021946713 7:25734863-25734885 CCAATTCAGTATAAGGAATAGGG - Intergenic
1023150774 7:37199584-37199606 CCCATGCCGGAGTAGGAAGAAGG + Intronic
1023581723 7:41690966-41690988 CCCTTGCTTTAGAATGAAGAGGG + Intronic
1024499518 7:50089497-50089519 CCACTTCTGTAGAAAGAAAAGGG + Intronic
1026548269 7:71344137-71344159 GCCATTCTGTGGGAGGCAGAAGG + Intronic
1027993429 7:85394491-85394513 CCCATATTGTAGAAGGGAGCTGG - Intergenic
1030330217 7:108262544-108262566 CCCATGCTGTAGAAAGATTATGG - Intronic
1030523909 7:110630607-110630629 CCCATTCTGTCCAGGGGAGAGGG + Intergenic
1032506667 7:132440380-132440402 CCCACGCTGGAGAAGGCAGACGG - Intronic
1032999682 7:137490663-137490685 ACCATAGTGTAGAAGGAAGGTGG - Intronic
1033008136 7:137589789-137589811 CCCCTTCCAAAGAAGGAAGAAGG + Intronic
1033320563 7:140335913-140335935 CCCAGTCTTTAGAAGCTAGATGG + Intronic
1033975225 7:147092914-147092936 TCCATGCTGTGGAAGGAAAAGGG + Intronic
1034300710 7:150013105-150013127 CCCATTGAGAAGAATGAAGAGGG - Intergenic
1034805340 7:154084195-154084217 CCCATTGAGAAGAATGAAGAGGG + Intronic
1035847605 8:2882226-2882248 GACATCCTGTAGAATGAAGACGG - Intergenic
1035847666 8:2882662-2882684 CCCACTCAGCAGAAGGAGGATGG - Intergenic
1036616025 8:10388333-10388355 CCCTCTCTGTACCAGGAAGACGG - Intronic
1037030804 8:14102378-14102400 CCCCTTCTGTAGATTGCAGATGG + Exonic
1037215355 8:16445060-16445082 CCCATTTTGTAGAATGAAAGTGG - Intronic
1037972076 8:23179449-23179471 CCCTTTCTGTACTAGAAAGATGG - Intergenic
1038500547 8:28040035-28040057 CCTCTTCTGGAGAAGGTAGATGG - Intronic
1043706616 8:83358447-83358469 ACCAGTCTGGAGAAGGAAGCAGG + Intergenic
1045766848 8:105682589-105682611 CCTATTCTCTACAAGGCAGAAGG - Intronic
1045956586 8:107915353-107915375 ACCAGTCGGGAGAAGGAAGAAGG - Intronic
1045998057 8:108386530-108386552 CCCATTCTGTAAAATTAAGTGGG - Intronic
1048094984 8:131282616-131282638 CACACTCTGTATAAGCAAGAAGG + Intergenic
1048243607 8:132768779-132768801 CCCCTTCTGCAGGAGGGAGAGGG - Intergenic
1048951962 8:139504056-139504078 CCCAGGTTCTAGAAGGAAGAGGG - Intergenic
1050908798 9:11039932-11039954 CCCAGTCTTTGGGAGGAAGAAGG - Intergenic
1052874188 9:33540907-33540929 CCCATTATGTAGAGGATAGATGG + Intronic
1053501857 9:38603436-38603458 CCCATTTTGTAGAGGATAGATGG - Intergenic
1054864893 9:69989964-69989986 CTGATTCTGTAGGAGGAAGCAGG - Intergenic
1055446695 9:76391070-76391092 ACCATTCTGTTGAATGAGGAAGG - Intronic
1055817419 9:80222892-80222914 CCCATTTTGTAGAATGAATTTGG + Intergenic
1056098935 9:83282016-83282038 CCCATTCTGTTTCAGCAAGAAGG + Intronic
1057154239 9:92826280-92826302 CCCATTATGTAGAGGGTAGATGG + Intergenic
1057681235 9:97187732-97187754 CCCATTATGTAGAGGGTAGACGG - Intergenic
1059015427 9:110510491-110510513 CCCATTCAGGAGGAGGAAGTTGG + Intronic
1060816948 9:126640073-126640095 CCCAATGTATAGAAAGAAGAAGG + Intronic
1185523806 X:761435-761457 CCCAGACTGTGGAAGGATGAGGG - Intergenic
1185922878 X:4113853-4113875 CCTATTCTGTTGAATAAAGAGGG + Intergenic
1186879888 X:13854293-13854315 CCCATTCTGTAGAACTACAAAGG + Intronic
1190332780 X:49246477-49246499 CCCATGCTGGAGAAGGATGTGGG - Intronic
1194447617 X:94007530-94007552 ACCAGTCTGGAGAAGGAAGGAGG + Intergenic