ID: 1068717053

View in Genome Browser
Species Human (GRCh38)
Location 10:60200171-60200193
Sequence CCGGCCAAGCTGAAGTTGTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 87}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068717053_1068717058 16 Left 1068717053 10:60200171-60200193 CCGCACAACTTCAGCTTGGCCGG 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1068717058 10:60200210-60200232 CAGTGCTGTTTCTCCTCTCTGGG 0: 1
1: 0
2: 3
3: 54
4: 345
1068717053_1068717057 15 Left 1068717053 10:60200171-60200193 CCGCACAACTTCAGCTTGGCCGG 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1068717057 10:60200209-60200231 GCAGTGCTGTTTCTCCTCTCTGG 0: 1
1: 0
2: 3
3: 31
4: 248
1068717053_1068717059 17 Left 1068717053 10:60200171-60200193 CCGCACAACTTCAGCTTGGCCGG 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1068717059 10:60200211-60200233 AGTGCTGTTTCTCCTCTCTGGGG 0: 1
1: 0
2: 2
3: 33
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068717053 Original CRISPR CCGGCCAAGCTGAAGTTGTG CGG (reversed) Exonic
903184487 1:21621709-21621731 CATGCCCAGCTGAGGTTGTGTGG - Intronic
903302863 1:22391486-22391508 CAGGCCAAGCTGAACATGGGAGG + Intergenic
904767554 1:32862116-32862138 CCAGCCAAGCTGGAGTTGGAAGG - Intergenic
904901275 1:33859216-33859238 CAGGCCAAGATCAAGGTGTGGGG + Intronic
904901693 1:33862682-33862704 GGGGACAAGCTGTAGTTGTGTGG - Intronic
906197220 1:43936580-43936602 CTGGCCAGGCTGAGGTCGTGTGG - Exonic
906294765 1:44642806-44642828 CAGGCCGAGCAGAAGATGTGAGG + Intronic
906614066 1:47223194-47223216 ACAGCCAAGCTGAAGTTCTGGGG + Intronic
908457251 1:64315783-64315805 CAGGACAAGCTGAAGTTGAGGGG + Intergenic
914858280 1:151367660-151367682 ACGCCCAAGCTGAAGTGCTGTGG + Intronic
917303747 1:173606116-173606138 CCAGCCCAGCTGATGCTGTGTGG - Intergenic
922567132 1:226608138-226608160 GAGGCCAAGCTGGGGTTGTGGGG - Exonic
1063856804 10:10264269-10264291 CTGCCCAAGCTGAAGCTGTGTGG + Intergenic
1065396104 10:25239566-25239588 TCACCCAAGCTGAAGTTCTGTGG - Intronic
1068717053 10:60200171-60200193 CCGGCCAAGCTGAAGTTGTGCGG - Exonic
1075144493 10:119872270-119872292 GCCGCCAAGGTGAAGTCGTGGGG - Intronic
1075446572 10:122517585-122517607 CAGGCCTCGCTGAGGTTGTGTGG + Intergenic
1080719859 11:34838251-34838273 CCTGCCGAACTGAAATTGTGGGG + Intergenic
1081701417 11:45155175-45155197 CCGGGAAAGCTGACATTGTGGGG - Intronic
1086490850 11:87356539-87356561 CGGGGCAGGCTGAAGTTGAGGGG + Intergenic
1095103222 12:38203993-38204015 CCTGCAAGGCTGAAGTTGTCTGG + Intergenic
1096237293 12:49938211-49938233 CCGGCCAAGCTGCAGCGGTGGGG + Intergenic
1107030258 13:35843676-35843698 CAGCCAAAGCTAAAGTTGTGTGG - Intronic
1110875435 13:80503891-80503913 CCTCACAAGCTAAAGTTGTGTGG + Intergenic
1114277645 14:21162030-21162052 CTGGCCAAGATGGAGTTGTGGGG + Intergenic
1120262184 14:82199741-82199763 TCGACCAAGTTGAAGTTGTAAGG - Intergenic
1123990508 15:25679917-25679939 ACGTGCCAGCTGAAGTTGTGTGG + Exonic
1126630488 15:50729579-50729601 CCGCCCAAGCTGGAGTTCAGTGG - Intronic
1129436703 15:75547253-75547275 TCGGCCAAGCTGAAGTGCAGTGG - Intronic
1132479192 16:158212-158234 TCGGCCAAGCTGGAGTTCAGTGG - Intronic
1133229659 16:4360532-4360554 CAGGCCAGGCTGAAGATCTGGGG + Exonic
1139574987 16:67835620-67835642 TCGCCCAAGCTGGAGTAGTGTGG - Exonic
1140029563 16:71324471-71324493 CCAGCCTAGCTGAAGGTGTCAGG - Intergenic
1140893482 16:79305262-79305284 GCGGCCAAGCTGCAGTTGCTCGG + Intergenic
1144017136 17:11207255-11207277 GCCCCCAAGCTGAATTTGTGGGG - Intergenic
1147670452 17:42173995-42174017 CCGGCCAAGCTGGAGTGCAGTGG + Intronic
1148216860 17:45838029-45838051 CCCTCCAAGCTGCAGTGGTGGGG + Intergenic
1148357944 17:46988638-46988660 CAGGCCAAGGTGGAGTTGAGGGG + Intronic
1149760488 17:59224787-59224809 TCGCCCAAGCTGAAGTTCAGCGG - Intronic
1152022975 17:77790747-77790769 CAGGCCCAGGTGAAGGTGTGGGG + Intergenic
1158237908 18:55340005-55340027 CCTGGCAAGATGAAGATGTGTGG - Intronic
1158306843 18:56115500-56115522 CCGGACAAGCAGAAGTTGGGAGG - Intergenic
1163161780 19:15469288-15469310 AAGGCCAGGCTGAGGTTGTGAGG + Intronic
1167667218 19:50829775-50829797 CCGCCCAAGCTGGAGTTCAGTGG - Intronic
928707282 2:33964078-33964100 CCAGCCAGGCTGAAGTGCTGTGG + Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
935205625 2:100894329-100894351 CCGGCCATTGTGAGGTTGTGAGG - Intronic
936840565 2:116763590-116763612 CCTGGGAACCTGAAGTTGTGAGG - Intergenic
944246485 2:197535591-197535613 AAGGCCAAGATGAAGGTGTGTGG + Exonic
946402054 2:219473318-219473340 GCAGCAAAGCTGAGGTTGTGGGG - Intronic
947165058 2:227253415-227253437 CGGGCCAAGCTGAAATTGATGGG + Intronic
1168758189 20:330308-330330 CCGGCCTAGCTGCAGTTGCTGGG - Intergenic
1169052840 20:2595193-2595215 CCAGCCATGCTGAAATTCTGGGG + Intronic
1178030996 21:28525936-28525958 CAGATCAAGCTGTAGTTGTGTGG - Intergenic
951535813 3:23739641-23739663 CCTGCCAAGCTGCAGTGCTGCGG - Intergenic
954198514 3:49010364-49010386 CCGCCCAAGCTGGAGTGCTGTGG - Intronic
960915421 3:122689669-122689691 CCTGCCATGTTGAACTTGTGAGG - Intronic
962967657 3:140369607-140369629 GCGGCCAAGCAGAAGTTGAAAGG - Intronic
963040444 3:141066165-141066187 CCGGCCAAGCGGGAGCTGCGGGG + Exonic
965170480 3:165257307-165257329 GCGGCCAAGGTGAAGTTTTAAGG - Intergenic
967641421 3:191869228-191869250 CCTGCCAAGCTGAAGAATTGTGG - Intergenic
968234941 3:197025991-197026013 CCGGCCAAGCAGAGGTGGCGGGG + Intronic
968508229 4:982250-982272 GAGGCCAAGCTGAGCTTGTGGGG - Intronic
986560975 5:9060602-9060624 CCAGCCAAGCTGATGCTGAGAGG - Intronic
987353632 5:17043252-17043274 CCGCCCAGGCTGGAGTTGGGTGG + Intergenic
990165240 5:52987463-52987485 CCTGCCTAGTTGCAGTTGTGAGG - Intergenic
998349937 5:141493971-141493993 CCCACCTAGCTGAAGGTGTGGGG - Intronic
998656015 5:144180591-144180613 GCTCCCCAGCTGAAGTTGTGTGG - Intronic
999991641 5:157055567-157055589 CCAGCCAAGATGAAATAGTGAGG - Intronic
1005330909 6:24749274-24749296 GGTGCCAAGGTGAAGTTGTGTGG + Intergenic
1006921505 6:37630530-37630552 CCTGGAAAGCTGAAGTTATGAGG + Intergenic
1012157225 6:95834594-95834616 CCTGAGAAGCTGAAGTTGAGAGG + Intergenic
1020018840 7:4849481-4849503 TCGGCCAGGCTGCAGCTGTGAGG + Intronic
1021034566 7:15782203-15782225 CAGGCCAAGCTGACTTTGAGAGG - Intergenic
1023903242 7:44501491-44501513 TCGCCCAAGCTGAAGTTCAGCGG + Intergenic
1028473912 7:91233399-91233421 ACGGCCACGCTGAATTTCTGAGG - Intergenic
1029393938 7:100294136-100294158 TCGGCCAGGCTGGAGTTGAGTGG - Intergenic
1036387580 8:8295500-8295522 CAGGCCAAGGTGAGGCTGTGGGG - Intergenic
1037181892 8:16017320-16017342 CCGGCCAAGCTGAAGTAAACGGG - Intergenic
1037810134 8:22081984-22082006 CAGGGCAAGCTGAAGTGGAGGGG - Exonic
1049158902 8:141084783-141084805 CAGGCCACGCTGAAGGTGGGCGG + Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1059967580 9:119630896-119630918 CTGTGCAAGCTGAAGTTCTGAGG + Intergenic
1060768713 9:126314664-126314686 TTGGCCAAGCGGAAGTGGTGGGG - Intergenic
1188127333 X:26385157-26385179 CAGGCCAAAGTGAAGTTTTGTGG + Intergenic
1190875891 X:54459817-54459839 TTGGCCAAGCTCAAGCTGTGAGG + Intronic
1195348992 X:103979392-103979414 CTGGTTAAGGTGAAGTTGTGAGG - Intergenic
1195358451 X:104059447-104059469 CTGGTTAAGGTGAAGTTGTGAGG + Intergenic