ID: 1068721672

View in Genome Browser
Species Human (GRCh38)
Location 10:60252784-60252806
Sequence AAGTACATCCAGAAGTAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 105}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068721672_1068721681 29 Left 1068721672 10:60252784-60252806 CCTGACTACTTCTGGATGTACTT 0: 1
1: 0
2: 1
3: 2
4: 105
Right 1068721681 10:60252836-60252858 ACCTGCGTCATGCTTTACAGGGG No data
1068721672_1068721675 -7 Left 1068721672 10:60252784-60252806 CCTGACTACTTCTGGATGTACTT 0: 1
1: 0
2: 1
3: 2
4: 105
Right 1068721675 10:60252800-60252822 TGTACTTTAGAGGGCTACCTTGG No data
1068721672_1068721679 27 Left 1068721672 10:60252784-60252806 CCTGACTACTTCTGGATGTACTT 0: 1
1: 0
2: 1
3: 2
4: 105
Right 1068721679 10:60252834-60252856 TGACCTGCGTCATGCTTTACAGG No data
1068721672_1068721680 28 Left 1068721672 10:60252784-60252806 CCTGACTACTTCTGGATGTACTT 0: 1
1: 0
2: 1
3: 2
4: 105
Right 1068721680 10:60252835-60252857 GACCTGCGTCATGCTTTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068721672 Original CRISPR AAGTACATCCAGAAGTAGTC AGG (reversed) Intronic
905963636 1:42068516-42068538 AAGTACATGATGAAGTATTCAGG + Intergenic
907574657 1:55515221-55515243 AAGTACATTTATAAGGAGTCTGG + Intergenic
916383380 1:164238732-164238754 AAGTACATAGAGAAGTAATAAGG - Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
918414636 1:184293963-184293985 AAGTACATCCTGTACTAGCCAGG - Intergenic
919252646 1:195078041-195078063 AAGTACTTCCTGAAGTGCTCTGG + Intergenic
922935737 1:229420856-229420878 AAGTGCATCCAGAATTGCTCTGG + Intergenic
1063440857 10:6071846-6071868 AAGTTCATCCAGTACCAGTCAGG - Intergenic
1065726193 10:28669786-28669808 AAGTGTATCCATAATTAGTCAGG + Intergenic
1068721672 10:60252784-60252806 AAGTACATCCAGAAGTAGTCAGG - Intronic
1070062822 10:73001664-73001686 ACATAGAACCAGAAGTAGTCAGG - Intergenic
1071391816 10:85183044-85183066 AAGTATCTCCATAAGTAGTTAGG - Intergenic
1072172350 10:92877736-92877758 AAGTATATCCAGAAGTAGTATGG - Intronic
1077299755 11:1841489-1841511 AAGAACATCGAGGAGAAGTCTGG + Exonic
1079556854 11:21769486-21769508 AATTACCCACAGAAGTAGTCAGG - Intergenic
1097253587 12:57655442-57655464 AAGTCCATACATAAGTAGGCAGG - Intergenic
1098896654 12:76070402-76070424 AAGTTCTTCCAGAAATAGGCTGG - Intronic
1099795225 12:87391899-87391921 AGGTACATCAAAAAGTAGTTAGG - Intergenic
1102869840 12:116405333-116405355 AAGTCCATCCAGAGGAAGTGAGG + Intergenic
1105846406 13:24297878-24297900 AAGTGCATTCAGAAGTATTTAGG - Intronic
1107104103 13:36625303-36625325 AAGCACATGTAGAAGTAGACAGG + Intergenic
1108670939 13:52687468-52687490 AAGGAAATCCTAAAGTAGTCAGG - Intronic
1110173466 13:72530205-72530227 AAGGACATCGTGAAGTGGTCAGG - Intergenic
1111345971 13:86954618-86954640 AAGTACATGTAGAAGTACTTTGG - Intergenic
1114010430 14:18360403-18360425 ATTTACAGCCAGAAGTATTCTGG - Intergenic
1115163355 14:30420363-30420385 CAGGACCTCCAGAAGTAGGCAGG + Intergenic
1117599577 14:57361716-57361738 AAGTACATCCATAGGTACTGGGG - Intergenic
1120541693 14:85759118-85759140 CAGTACATTCAGAAGTAGCTTGG - Intergenic
1124655270 15:31502122-31502144 AAGTACATCCAGAAAAAGGTGGG - Intronic
1126587043 15:50299304-50299326 AATTACATCAAGAAGTATTTTGG + Intronic
1126707208 15:51416719-51416741 AAGTCCATACATCAGTAGTCAGG + Intergenic
1129540426 15:76343182-76343204 AAGTCCACCCAGAACCAGTCTGG + Intergenic
1131412860 15:92225442-92225464 AAGTATATCCAGAAGCAATAAGG + Intergenic
1135326953 16:21532515-21532537 AAATACAACCAAAAGTAATCTGG - Intergenic
1135499980 16:22987221-22987243 AAGCACATACAGAAGTAGAGAGG + Intergenic
1135596891 16:23751638-23751660 ATGAACATCCAGGAATAGTCAGG - Intergenic
1135825961 16:25729126-25729148 GGGTACATCAAGAAGGAGTCTGG + Intronic
1136193284 16:28631771-28631793 AAGTCCATACAGAAGTAGAGAGG - Intergenic
1136337211 16:29617925-29617947 AAATACAACCAAAAGTAATCTGG - Intergenic
1138115603 16:54358239-54358261 CAGCACAGCCAGACGTAGTCAGG + Intergenic
1139979052 16:70838556-70838578 AAGTGCTTCCAGAAGTAATTAGG + Intronic
1140400042 16:74664321-74664343 GAGTACATCTAGAAGTAGCTTGG - Intronic
1141700023 16:85638110-85638132 AGGCACTTCCAGAAGTCGTCAGG - Intronic
1142368160 16:89661580-89661602 AAGCATATACAGAAGTAGTAGGG - Intronic
1142570464 17:870281-870303 AAGTTCATCCAGAAAGATTCCGG + Intronic
1144154553 17:12486581-12486603 ATGTAGATCCAGAAGGACTCAGG - Intergenic
1144729535 17:17518545-17518567 CAGTGCATCCAGAGGTGGTCAGG - Intronic
1152641260 17:81450255-81450277 AAGGACATCCAGCAGGAGACAGG - Intronic
1159741413 18:72175854-72175876 AATTACATGCAGATGTAGTATGG - Intergenic
1162968791 19:14167980-14168002 AAGCAAATCCAGCATTAGTCGGG + Intronic
927607195 2:24496740-24496762 AAGTCCATGCAGATGTAGTTGGG + Intronic
929963818 2:46518667-46518689 AAGTACATCCTAAAGTAATGAGG - Intronic
930311840 2:49751961-49751983 AAATACTTCCAGAAGAAGTATGG + Intergenic
931372863 2:61680277-61680299 CAGTACATCCAGAACCAATCTGG - Intergenic
931838827 2:66127857-66127879 ATGTACTTCCGGAAGCAGTCGGG - Intergenic
931890554 2:66666675-66666697 AAGTGCCTCTAGAAGTATTCTGG + Intergenic
939029177 2:137049633-137049655 AAGTACATCCAGCAAGATTCAGG - Intronic
945823724 2:214696293-214696315 AGGTAGAGCAAGAAGTAGTCAGG - Intergenic
1173802446 20:45902858-45902880 AAGGACATCCACAAAGAGTCTGG - Intronic
1174000549 20:47371403-47371425 AAGTACATCCTGTATCAGTCTGG + Intergenic
1174433497 20:50488561-50488583 AAGTACAACCATAAATAGTACGG + Intergenic
1177545996 21:22559951-22559973 AAGTACATCCAAAAGAAGATAGG - Intergenic
1178442063 21:32606384-32606406 AAGTACTTTCAGAAGTACACAGG + Intronic
1180434923 22:15291203-15291225 ATTTACAGCCAGAAGTATTCTGG - Intergenic
1180517129 22:16155015-16155037 ATTTACAGCCAGAAGTATTCTGG - Intergenic
949195581 3:1302297-1302319 AAGTACATCACAAAGTAGACAGG - Intronic
956039036 3:65126576-65126598 AAGTACTTACAGAATTAGCCTGG - Intergenic
956393631 3:68801093-68801115 ATTTAAATCCAGAAGAAGTCTGG - Intronic
958879387 3:99652559-99652581 AATCACATCCAGAAATAGTTTGG + Intronic
960087734 3:113608756-113608778 AAGGACATCCAGATGTAGAAAGG + Intronic
965911080 3:173776634-173776656 ATTTACATCAGGAAGTAGTCAGG - Intronic
966708576 3:182946656-182946678 AAGTACATCAAGAAGTAAAAAGG + Intronic
967318312 3:188171326-188171348 AAATGAATCCAGAAGCAGTCAGG - Intronic
967929223 3:194678579-194678601 AAGCACATCCACAAGTACTAGGG - Intergenic
975318317 4:72980497-72980519 AAATAGATACAGAAGTAATCAGG + Intergenic
994626370 5:102225191-102225213 GAATAGATCCAGAAGTAGTTTGG - Intergenic
1000717676 5:164666794-164666816 AAGTACAACTAGCAGTAGTTTGG + Intergenic
1004271304 6:14198382-14198404 AGGTAAATCCAGATGTATTCAGG + Intergenic
1005744639 6:28825169-28825191 AAGTTCATTCAGAAGTAAACGGG + Intergenic
1006133457 6:31882332-31882354 AAGAACATCCAGAAGCAGAGAGG + Intronic
1009498384 6:64379376-64379398 AAGTAAAACAAGAAGTAATCTGG - Intronic
1010949292 6:82016087-82016109 AAGAACATTCAGTAGTAGGCAGG + Intergenic
1012445520 6:99303492-99303514 AAGTTCATGAAGAAGTATTCTGG + Intronic
1019387479 7:765854-765876 AAAAACATACAGAAGTAGCCAGG - Intronic
1020450221 7:8313392-8313414 AAGTACATCAAGAAGGTATCTGG - Intergenic
1022653379 7:32297374-32297396 AAGTACTTCCAAAAGTACTGTGG - Intronic
1029818340 7:103120515-103120537 CAGTACTGCCAGAAGTAGACTGG + Intronic
1030474405 7:110011458-110011480 AAGTTCATCTAGCTGTAGTCTGG + Intergenic
1032285226 7:130534593-130534615 GAGTAAATCCAGTGGTAGTCAGG + Intronic
1037096916 8:14996709-14996731 AAGGAGATCCAGAAGATGTCTGG - Intronic
1040768952 8:50950123-50950145 CAGAACAGCCAGAAGTACTCTGG + Intergenic
1043078819 8:75738255-75738277 AAGTACATCCATAAGCTGTGAGG - Intergenic
1045126119 8:99090837-99090859 AAGTAAATACAGAACTACTCTGG - Intronic
1051570372 9:18550290-18550312 AAGTATATCCTGGAGTATTCAGG + Intronic
1053100594 9:35368958-35368980 AGCTACATTCAGAAGTAGTCTGG - Intronic
1053705198 9:40746284-40746306 ATTTACAGCCAGAAGTATTCTGG + Intergenic
1054415275 9:64869891-64869913 ATTTACAGCCAGAAGTATTCTGG + Intergenic
1055316475 9:75039286-75039308 AACTCTATCCAGAAATAGTCAGG - Intergenic
1186155141 X:6717509-6717531 AAGTGCTTCCAGGAGGAGTCTGG - Intergenic
1187357939 X:18595859-18595881 AAGTAGAGCCAGAAAGAGTCTGG - Intronic
1188631836 X:32373004-32373026 GAGAACTTCCAGAAGTAGTGAGG - Intronic
1189237495 X:39498653-39498675 AGGTACATGCAGAAGTATTTAGG + Intergenic
1190223485 X:48528308-48528330 AAGTAAAACCAGAAGTAGAGAGG - Exonic
1190549010 X:51559332-51559354 AAGTATAGCCACAAGTTGTCTGG - Intergenic
1191613506 X:63142257-63142279 TAGTACAGAGAGAAGTAGTCTGG - Intergenic
1191622791 X:63236670-63236692 TAGTACAGAGAGAAGTAGTCTGG + Intergenic
1195071719 X:101287609-101287631 CAGTACTACCAGAAGTGGTCAGG - Intronic
1196364801 X:114912322-114912344 AAGTACATGCATAATTAGTCAGG - Intergenic
1196513749 X:116546011-116546033 AGGGACACACAGAAGTAGTCTGG + Intergenic