ID: 1068721994

View in Genome Browser
Species Human (GRCh38)
Location 10:60255883-60255905
Sequence CCTTCCTCACTGGGGCCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068721988_1068721994 2 Left 1068721988 10:60255858-60255880 CCCAGGTGTAGAGAAAACAGACT 0: 1
1: 1
2: 3
3: 19
4: 325
Right 1068721994 10:60255883-60255905 CCTTCCTCACTGGGGCCCAGAGG No data
1068721989_1068721994 1 Left 1068721989 10:60255859-60255881 CCAGGTGTAGAGAAAACAGACTT 0: 1
1: 0
2: 1
3: 17
4: 196
Right 1068721994 10:60255883-60255905 CCTTCCTCACTGGGGCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068721994 Original CRISPR CCTTCCTCACTGGGGCCCAG AGG Intronic
No off target data available for this crispr