ID: 1068724979

View in Genome Browser
Species Human (GRCh38)
Location 10:60290738-60290760
Sequence GTTTGAAATGTGCACCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068724979_1068724985 2 Left 1068724979 10:60290738-60290760 CCCTGCTGGTGCACATTTCAAAC No data
Right 1068724985 10:60290763-60290785 GCTGGGGTGTCTGTGCACAGTGG No data
1068724979_1068724986 21 Left 1068724979 10:60290738-60290760 CCCTGCTGGTGCACATTTCAAAC No data
Right 1068724986 10:60290782-60290804 GTGGCCACTCTCATGCTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068724979 Original CRISPR GTTTGAAATGTGCACCAGCA GGG (reversed) Intronic