ID: 1068724980 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:60290739-60290761 |
Sequence | GGTTTGAAATGTGCACCAGC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1068724980_1068724985 | 1 | Left | 1068724980 | 10:60290739-60290761 | CCTGCTGGTGCACATTTCAAACC | No data | ||
Right | 1068724985 | 10:60290763-60290785 | GCTGGGGTGTCTGTGCACAGTGG | No data | ||||
1068724980_1068724986 | 20 | Left | 1068724980 | 10:60290739-60290761 | CCTGCTGGTGCACATTTCAAACC | No data | ||
Right | 1068724986 | 10:60290782-60290804 | GTGGCCACTCTCATGCTGAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1068724980 | Original CRISPR | GGTTTGAAATGTGCACCAGC AGG (reversed) | Intronic | ||