ID: 1068724985

View in Genome Browser
Species Human (GRCh38)
Location 10:60290763-60290785
Sequence GCTGGGGTGTCTGTGCACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068724980_1068724985 1 Left 1068724980 10:60290739-60290761 CCTGCTGGTGCACATTTCAAACC No data
Right 1068724985 10:60290763-60290785 GCTGGGGTGTCTGTGCACAGTGG No data
1068724975_1068724985 18 Left 1068724975 10:60290722-60290744 CCTGTGCCAGAAAGGCCCCTGCT No data
Right 1068724985 10:60290763-60290785 GCTGGGGTGTCTGTGCACAGTGG No data
1068724977_1068724985 12 Left 1068724977 10:60290728-60290750 CCAGAAAGGCCCCTGCTGGTGCA No data
Right 1068724985 10:60290763-60290785 GCTGGGGTGTCTGTGCACAGTGG No data
1068724979_1068724985 2 Left 1068724979 10:60290738-60290760 CCCTGCTGGTGCACATTTCAAAC No data
Right 1068724985 10:60290763-60290785 GCTGGGGTGTCTGTGCACAGTGG No data
1068724978_1068724985 3 Left 1068724978 10:60290737-60290759 CCCCTGCTGGTGCACATTTCAAA No data
Right 1068724985 10:60290763-60290785 GCTGGGGTGTCTGTGCACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068724985 Original CRISPR GCTGGGGTGTCTGTGCACAG TGG Intronic