ID: 1068724986

View in Genome Browser
Species Human (GRCh38)
Location 10:60290782-60290804
Sequence GTGGCCACTCTCATGCTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068724984_1068724986 -1 Left 1068724984 10:60290760-60290782 CCTGCTGGGGTGTCTGTGCACAG No data
Right 1068724986 10:60290782-60290804 GTGGCCACTCTCATGCTGAAAGG No data
1068724978_1068724986 22 Left 1068724978 10:60290737-60290759 CCCCTGCTGGTGCACATTTCAAA No data
Right 1068724986 10:60290782-60290804 GTGGCCACTCTCATGCTGAAAGG No data
1068724979_1068724986 21 Left 1068724979 10:60290738-60290760 CCCTGCTGGTGCACATTTCAAAC No data
Right 1068724986 10:60290782-60290804 GTGGCCACTCTCATGCTGAAAGG No data
1068724980_1068724986 20 Left 1068724980 10:60290739-60290761 CCTGCTGGTGCACATTTCAAACC No data
Right 1068724986 10:60290782-60290804 GTGGCCACTCTCATGCTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068724986 Original CRISPR GTGGCCACTCTCATGCTGAA AGG Intronic