ID: 1068726574

View in Genome Browser
Species Human (GRCh38)
Location 10:60309617-60309639
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068726571_1068726574 -10 Left 1068726571 10:60309604-60309626 CCAACACACATCTCTGGAGATGA 0: 1
1: 0
2: 4
3: 49
4: 365
Right 1068726574 10:60309617-60309639 CTGGAGATGAATAAGGAGGTTGG No data
1068726569_1068726574 17 Left 1068726569 10:60309577-60309599 CCAGGGGGGTGTTCTGAAACTAT No data
Right 1068726574 10:60309617-60309639 CTGGAGATGAATAAGGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr