ID: 1068729866

View in Genome Browser
Species Human (GRCh38)
Location 10:60345101-60345123
Sequence CATGTACAGCATCCTTAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 89}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068729866_1068729870 15 Left 1068729866 10:60345101-60345123 CCCAACTAAGGATGCTGTACATG 0: 1
1: 0
2: 0
3: 2
4: 89
Right 1068729870 10:60345139-60345161 TGAGCATTAAACTAGATTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068729866 Original CRISPR CATGTACAGCATCCTTAGTT GGG (reversed) Intronic
903111493 1:21138448-21138470 CATGTACAACCTCCTTGGTTTGG - Intronic
903650180 1:24917233-24917255 CATGGACAGGAGCCTCAGTTGGG - Intronic
903937734 1:26908288-26908310 CATGATCAGCATCCTGGGTTGGG - Intronic
912535015 1:110361035-110361057 AATGTACAGCTTGCTTAGCTAGG + Intergenic
922179113 1:223219718-223219740 CATGTCCAGCATCCTAGGTGAGG - Intergenic
1068729866 10:60345101-60345123 CATGTACAGCATCCTTAGTTGGG - Intronic
1069867944 10:71515199-71515221 CAAGTTCAGCCTCCTTAGCTGGG + Intronic
1070467132 10:76734706-76734728 CATGTACATCATCATCAGTAAGG + Intergenic
1071089758 10:81904588-81904610 CATGGACAGGCTCCTTATTTTGG - Intronic
1085572543 11:77571908-77571930 CATCTCCAGTTTCCTTAGTTGGG - Intronic
1086079334 11:82887075-82887097 CATGTACAAGATCCTAAGGTAGG - Intronic
1090598520 11:128345335-128345357 CATGTCCATCATCCTTGATTTGG - Intergenic
1091252037 11:134152231-134152253 CATGAACAGCATCCCTTCTTGGG - Intronic
1093069473 12:14693571-14693593 CATGTTGAGCATCATTATTTGGG - Intronic
1109044294 13:57388679-57388701 CATGTACAACAACCTTCATTTGG - Intergenic
1117601668 14:57382185-57382207 AATGTATATCATCTTTAGTTTGG - Intergenic
1119205947 14:72793644-72793666 CATGTAGAGCATCCAAAGATGGG + Intronic
1119275570 14:73352097-73352119 CACGTACAAAATCCTTAGTATGG + Intronic
1122999436 14:105284557-105284579 CATGTCCTGCAGCCTTAGTGTGG - Intronic
1124908943 15:33899102-33899124 GAAGTACAGAATCCTTATTTAGG - Intronic
1129861572 15:78866995-78867017 CATGTAGAGAATGCTTATTTTGG + Intronic
1130872705 15:87983862-87983884 TATTAACAGCTTCCTTAGTTAGG + Intronic
1139404033 16:66704252-66704274 CATGTTTAGCATCTTTAGGTAGG + Intergenic
1145166962 17:20621319-20621341 CATGTACAACATCCTCTTTTGGG - Intergenic
1147446581 17:40478540-40478562 CCTGGACAGCCTTCTTAGTTTGG + Intronic
1151618954 17:75233296-75233318 CATGTCCAGGATCATGAGTTTGG + Intronic
1154110093 18:11560278-11560300 CAAGTACATCATCCTTAAATGGG + Intergenic
1159484310 18:69034733-69034755 CATGCACAGCATCCACAGTGGGG - Intronic
1167085475 19:47306862-47306884 CATGTCCAGGCTCCTTAGCTCGG + Intronic
929276503 2:40031617-40031639 CAAGTACAACATCCTTCATTAGG - Intergenic
933467493 2:82673212-82673234 CATGAACCTCATCCTTATTTAGG - Intergenic
935317569 2:101851345-101851367 CATGTTTATCATTCTTAGTTGGG + Intronic
936273819 2:111073932-111073954 CATGTACATCATCCTTATGCTGG - Intronic
942864968 2:180662508-180662530 CACGTACAGCATTATTAGCTGGG - Intergenic
946239898 2:218347362-218347384 CATGTACAGCCACCCTACTTTGG - Intergenic
946612837 2:221477895-221477917 CATCTGTAGCATGCTTAGTTTGG - Intronic
947521052 2:230846351-230846373 CAGGTACAGCATGACTAGTTAGG + Intergenic
948070442 2:235117277-235117299 CATATACAACATCATAAGTTAGG - Intergenic
1168748899 20:268204-268226 CATGTACAGCATCTGTACATGGG - Intergenic
1169593586 20:7172569-7172591 CATGAACAGCATCGTTATTAGGG - Intergenic
1170282575 20:14667423-14667445 TATGCACAGCTTCCTTATTTTGG + Intronic
1175618767 20:60425287-60425309 CATCTTCAGCATCCTTAGCCAGG + Intergenic
1176244915 20:64092936-64092958 CATGTACGTCATCCTCAGGTAGG + Exonic
1177690318 21:24498081-24498103 CATGTTCAGCAGGCTGAGTTGGG - Intergenic
1178942891 21:36922468-36922490 CAGGTACAGCATGCCGAGTTTGG - Intronic
950495474 3:13331522-13331544 CATGGACAGCACCCTTCTTTGGG + Intronic
951580270 3:24155706-24155728 CATGTGCATTTTCCTTAGTTTGG - Intronic
953420753 3:42751556-42751578 CCTGTACAGCATCCTCACTGGGG - Intronic
955756119 3:62226912-62226934 CATGAACAGCATTCTTAATGAGG - Intronic
955857945 3:63294503-63294525 CGTGAACAGCATCATGAGTTTGG - Intronic
966988549 3:185204680-185204702 CATGGACAGCATTTTTAGTGAGG - Exonic
970012593 4:11476159-11476181 CTTGTACAGCATCCCTTGCTTGG + Intergenic
974407311 4:61490804-61490826 ATTGTAAAGCATCATTAGTTTGG - Intronic
976245241 4:83000627-83000649 CAAATACAGCATCTTTAATTTGG + Intronic
976406915 4:84670291-84670313 CATGTACATCTACCTTAGTATGG - Exonic
976821696 4:89214195-89214217 GATGTCCAGCATCCCTAGATTGG + Intergenic
978453021 4:108857449-108857471 CTTGGACAGTATCTTTAGTTAGG - Intronic
984244277 4:177256322-177256344 CGTGGCCAGCATCCTCAGTTTGG + Intergenic
984969605 4:185176086-185176108 CATGTACCACATACTTACTTTGG - Intronic
985089165 4:186345832-186345854 CATGTGCAGCATCCATATCTAGG - Intergenic
991146284 5:63308845-63308867 TATCTACACCATCATTAGTTAGG + Intergenic
993049580 5:82911248-82911270 AATGTACAGCCTACTCAGTTTGG + Intergenic
993616199 5:90115418-90115440 TATGTCCAGCATGCTTTGTTAGG - Intergenic
998926526 5:147132082-147132104 CATGTAAGGCACCGTTAGTTAGG + Intergenic
999938136 5:156510637-156510659 CTTGAATAGCATTCTTAGTTTGG + Intronic
1002953437 6:1838942-1838964 CAAGTTCAGCATCCTTACATGGG - Intronic
1007832988 6:44653059-44653081 TATGCACAGCGTCCTTGGTTTGG + Intergenic
1008206715 6:48669086-48669108 AATTTACAGCATCCTAAATTAGG + Intergenic
1012199514 6:96388122-96388144 CATGAACAGCATTCATTGTTAGG - Intergenic
1013264355 6:108480197-108480219 CATGTTCAGCAGTCTGAGTTAGG + Intronic
1013280510 6:108632072-108632094 CAGGTTCAGCCTTCTTAGTTGGG + Intronic
1013646062 6:112142548-112142570 CATGAACAGTATACTTGGTTTGG + Intronic
1014198487 6:118584158-118584180 CCTGAAAAGCATCCTCAGTTGGG - Intronic
1015190805 6:130470073-130470095 CATTTTCAGCATCATCAGTTAGG + Intergenic
1019899693 7:4010584-4010606 CATGTGCAGCATCCTTTTCTGGG + Intronic
1020692615 7:11375151-11375173 CTTGTCCAGCATTCTTACTTTGG + Exonic
1021836498 7:24681669-24681691 CATGTACAGCTTGATCAGTTTGG + Intronic
1031903130 7:127431390-127431412 TACGTACAGCATCATTATTTGGG - Intronic
1032288421 7:130562637-130562659 CATTTACAGCATACTCAGTTTGG - Intronic
1036388620 8:8305191-8305213 CCTGTCCAGCCTCCTTAGTAAGG - Intergenic
1036716602 8:11130639-11130661 CTTTTACATCATCCTTAGGTGGG - Intronic
1040249884 8:45581340-45581362 AATGTTCAGCACACTTAGTTGGG - Intergenic
1041789477 8:61676892-61676914 CATTTATAGCATCCATAGGTGGG + Intronic
1046544647 8:115634300-115634322 CATGTAAAGCATTCATAGATTGG - Intronic
1048824731 8:138412921-138412943 CATGTGCAGAAGCCTTTGTTGGG + Intronic
1050441975 9:5674038-5674060 CATTTACAGTATCATCAGTTTGG + Intronic
1186771065 X:12818605-12818627 CATGTACTGCGTCTTAAGTTGGG + Intronic
1186878798 X:13843679-13843701 GATGTTCAACATCATTAGTTGGG - Intronic
1187956584 X:24524668-24524690 AATTTACAGCATCCCTAATTTGG + Intronic
1195632978 X:107079078-107079100 CTTGCACAGCATCCTTATCTTGG - Intronic
1197213757 X:123849170-123849192 CATGAACAGAATGCTTATTTAGG - Intergenic
1198679238 X:139163832-139163854 AATGCACAGCATCCTTAGACTGG - Intronic