ID: 1068730654

View in Genome Browser
Species Human (GRCh38)
Location 10:60354191-60354213
Sequence AGATGTGCCATGCATCTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 142}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068730654 Original CRISPR AGATGTGCCATGCATCTTGG GGG (reversed) Intronic
900475639 1:2875125-2875147 AGATCTGCCATGCGTCTGTGTGG - Intergenic
902219814 1:14957849-14957871 AGATGTGCCTTGCACCTCAGAGG + Intronic
905051976 1:35059721-35059743 AGAGTTGCAATGCACCTTGGTGG + Intergenic
907308898 1:53528315-53528337 TGATGTGGCAGGCATCTTGGGGG - Intronic
908547416 1:65175482-65175504 GGCTGTGCCATGCACCTTGTTGG - Intronic
909774485 1:79466986-79467008 AGATTTGACATGTATCATGGTGG + Intergenic
912002881 1:104856882-104856904 ATATTAGCCATGCATGTTGGTGG - Intergenic
912129604 1:106585545-106585567 AGATGTACCCTTAATCTTGGTGG - Intergenic
920211344 1:204331045-204331067 AAATTAGCCATGCATGTTGGCGG + Intronic
924358641 1:243212096-243212118 AGATGTGCCATGCAGCCTGTAGG + Intronic
1064402406 10:15032471-15032493 AAATGAGCTATGCATCGTGGAGG + Intronic
1068730654 10:60354191-60354213 AGATGTGCCATGCATCTTGGGGG - Intronic
1069009842 10:63360165-63360187 AGATTTGCCAGGCATGGTGGTGG + Intronic
1069256765 10:66342285-66342307 ATATGTGCCAGGCATTTTGTTGG - Intronic
1073424864 10:103450235-103450257 AGGGGTGCCATGCACCCTGGAGG - Intronic
1074719877 10:116255203-116255225 TTATGTTCCATGCATTTTGGTGG - Intronic
1074802359 10:117013728-117013750 ACATTTGCCATACAACTTGGTGG + Intronic
1075290771 10:121228698-121228720 AGATGTTGCAGACATCTTGGGGG - Intergenic
1075967998 10:126629437-126629459 AGATGTGCTGTGCATCAGGGAGG - Intronic
1077238412 11:1496686-1496708 AGCTGTGCATTGCATCTTGGTGG - Intronic
1078054843 11:8000052-8000074 AAATTAGCCAGGCATCTTGGAGG + Exonic
1081757127 11:45552635-45552657 GGATGTGGGCTGCATCTTGGGGG - Intergenic
1085473465 11:76773103-76773125 AGAATTGCCAGGCCTCTTGGAGG + Intergenic
1085865649 11:80288470-80288492 AGATGTTCCATGTAGCTTGAAGG - Intergenic
1086833564 11:91595415-91595437 AGATGTGTCATTTATCTTGAGGG - Intergenic
1087175998 11:95096263-95096285 AGATATAACATGCATCTTGAAGG - Intronic
1087343402 11:96937430-96937452 AGATGTGCCCTTCTTCTTGAGGG + Intergenic
1089394752 11:118129296-118129318 AGAGGTGCCAAGAATCTGGGGGG - Intergenic
1089703162 11:120257848-120257870 AAATGAACCATGCATTTTGGTGG + Intronic
1089897080 11:121941448-121941470 AAATGAGCCAGGCATCATGGCGG - Intergenic
1089955597 11:122568225-122568247 AAATTAGCCAGGCATCTTGGTGG + Intergenic
1090044608 11:123320169-123320191 TTATGTGCCAGGCATCTTGCTGG + Intergenic
1091677981 12:2505109-2505131 AGATGTGCCACTGGTCTTGGTGG + Intronic
1093799636 12:23357705-23357727 TTATGTGGCATGCGTCTTGGAGG - Intergenic
1099506840 12:83488407-83488429 AGAGGTGACATGAATCTTGGAGG + Intergenic
1099964364 12:89429697-89429719 AGATGAGCCAGGCATTGTGGGGG - Intronic
1100225121 12:92548804-92548826 AGATGTGCCAGGCATTTGGGAGG + Intergenic
1103705534 12:122869441-122869463 TGAGGTGCCGTGCATCTTGCTGG - Intronic
1106618940 13:31355594-31355616 AGGTGTGCCATGCAAGTTGTTGG - Intergenic
1106654825 13:31732133-31732155 AGATGTGAGATGTATTTTGGAGG - Intergenic
1106767959 13:32934199-32934221 TTATGTCCCATGCATTTTGGTGG + Intergenic
1107521094 13:41182498-41182520 GCATGTTCCAAGCATCTTGGTGG - Intergenic
1108497133 13:51036112-51036134 AGCTGTGCTGTGCATCCTGGAGG + Intergenic
1109673442 13:65639796-65639818 AGATCTGCCATCCATCTGGAAGG + Intergenic
1111977693 13:94984121-94984143 AGACATGCCATGCATTTTTGTGG + Intergenic
1115454659 14:33588315-33588337 GGATCTGCCCTGCATCTGGGAGG - Intronic
1117427619 14:55617465-55617487 AGATGTGCCATGGAAATTAGAGG + Intronic
1118086947 14:62428740-62428762 AAGTGAGCCATGAATCTTGGTGG + Intergenic
1119144646 14:72300736-72300758 CCATGTGCCTGGCATCTTGGCGG + Intronic
1119422069 14:74513158-74513180 AGATGTGCCCAGCATGTTTGGGG - Intronic
1123183184 14:106489088-106489110 AGATGTACCTTTCATTTTGGAGG - Intergenic
1202882312 14_KI270722v1_random:72224-72246 AAATTTGCCAAGCATCGTGGCGG + Intergenic
1125928102 15:43579988-43580010 AAATGAGCCAGGCATATTGGTGG - Intronic
1125941246 15:43679546-43679568 AAATGAGCCAGGCATATTGGTGG - Intergenic
1128492519 15:68162971-68162993 AGATGTGCCCTCAATCTTGGCGG - Intronic
1128577079 15:68783652-68783674 AGCTTTCCCATGCATCTTCGTGG - Intronic
1129328042 15:74812430-74812452 AGATGTGCCATCCATGCTGGGGG + Intergenic
1133390566 16:5406906-5406928 TGATGTGGGATTCATCTTGGAGG + Intergenic
1134566055 16:15252845-15252867 TGATGTGCCAGGCACCTTGGTGG + Intergenic
1134736439 16:16503853-16503875 TGATGTGCCAGGCACCTTGGTGG - Intergenic
1134931075 16:18208315-18208337 TGATGTGCCAGGCACCTTGGTGG + Intergenic
1139219180 16:65161549-65161571 ACATTTGCCATTCATTTTGGTGG + Intergenic
1145252352 17:21303551-21303573 AGAATTGTCCTGCATCTTGGAGG - Intronic
1146678396 17:34789704-34789726 AGCTGTGCCCTGCATGGTGGTGG - Intergenic
1147031843 17:37644559-37644581 AGATCTGGCATGTATTTTGGAGG + Intergenic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1154944028 18:21143159-21143181 AGATGTACCATGTATATTCGTGG - Intergenic
1156373668 18:36493401-36493423 AAATGAGCCATGCTTCCTGGGGG + Intronic
1157395620 18:47338350-47338372 AGATGTGCATTGCCTCTAGGAGG - Intergenic
1158140866 18:54254084-54254106 ACATGTGCCATACATCTTACAGG + Intergenic
1158800142 18:60896570-60896592 AAATGTGCCAGGCTTGTTGGTGG - Intergenic
1164622886 19:29707802-29707824 AGTGGTGCCATGCGTCTTGTGGG - Intronic
1166675534 19:44738542-44738564 AGATGCCCCATGCATCTTCACGG + Intergenic
1166962593 19:46507819-46507841 AGATGTGACATGCACCAAGGAGG + Intronic
1202657923 1_KI270708v1_random:41322-41344 AAATTTGCCAAGCATCGTGGCGG + Intergenic
926216143 2:10906593-10906615 AGGTGTGGCATTCATTTTGGGGG + Intergenic
926860236 2:17301377-17301399 TGAAGTGCCATGCCTGTTGGTGG - Intergenic
927259414 2:21072003-21072025 AGATGTGCAAAGCAGTTTGGAGG + Intergenic
927993513 2:27465368-27465390 AGAGGTGCCACGCAGCTAGGAGG - Intronic
931252387 2:60544787-60544809 AGACATGCCATGCCTGTTGGTGG - Intronic
931358511 2:61557827-61557849 AGATGTGCCAGGTATGGTGGAGG + Intergenic
935605362 2:104967399-104967421 TGAAGCGGCATGCATCTTGGGGG - Intergenic
936574314 2:113640968-113640990 AGAGATCCCATGCATCGTGGTGG + Exonic
936629535 2:114186823-114186845 AGATGTTCCAAGCATCTGGATGG + Intergenic
940393443 2:153160252-153160274 TGATGGGCCATGCATCTTGTTGG + Intergenic
941292611 2:163695782-163695804 AGATGTGCTAAGCATTTTGCTGG - Intronic
942767686 2:179476055-179476077 ACATGTGGCAGGCATTTTGGGGG - Intronic
943903934 2:193474362-193474384 AAATGAGCCAGGCATGTTGGTGG - Intergenic
1168975900 20:1965800-1965822 AGATGAGCCATGCACGTTGAGGG - Intergenic
1170359159 20:15525442-15525464 AGATGTGCCATTTTTCTTGTTGG - Intronic
1171022047 20:21594093-21594115 TGATGTGCCCAGCATATTGGAGG - Intergenic
1172785084 20:37463440-37463462 AAATTAGCCAGGCATCTTGGCGG - Intergenic
1173667549 20:44773695-44773717 AGCTGTGCCTTGCATCTGTGTGG + Intronic
1174887203 20:54348899-54348921 AGAAGTGCCAAGTATCTGGGAGG + Intergenic
1175229693 20:57465882-57465904 AGATTTTCCCTGCATCTTTGTGG + Intergenic
1178743916 21:35229112-35229134 TGATGTCCAATGCATCTTGGTGG - Intronic
1178940297 21:36899953-36899975 AAATTAGCCATGCATCGTGGTGG + Intronic
1179074724 21:38109409-38109431 AAATGTGGCAAACATCTTGGAGG - Intronic
1179074769 21:38109779-38109801 AAATGTGGCAAACATCTTGGAGG - Intronic
1181547507 22:23610439-23610461 AGATGTGAAAAGCATCCTGGAGG - Intronic
1182889835 22:33808463-33808485 ATTTGTGCCAAGCACCTTGGTGG - Intronic
1183669055 22:39261523-39261545 ATATGGGCCATGCCTCTTGTGGG - Intergenic
1185425858 22:50769920-50769942 AGAGATCCCATGCATCGTGGTGG - Exonic
956556071 3:70524419-70524441 AAATGTGCCATGCATCTGAATGG - Intergenic
957036752 3:75300715-75300737 GGATCTGCCAGGCATCCTGGAGG - Intergenic
958594185 3:96201011-96201033 GGATGTGGCATCTATCTTGGGGG - Intergenic
958990001 3:100831773-100831795 ATATTTGCCATGCTTCTAGGAGG + Intronic
959397738 3:105862474-105862496 AGATGTGGGAGGCATTTTGGAGG - Intronic
961550570 3:127668515-127668537 AGATGTGCCAGGCCCCATGGTGG - Exonic
962795035 3:138842558-138842580 AGATGTGGCTTGGATCATGGAGG - Intergenic
964187319 3:153962450-153962472 AGATATTCCATGGATCTTGTTGG - Intergenic
967881683 3:194306107-194306129 AGATATCCCAAGCATCTTGAAGG - Intergenic
975462783 4:74674114-74674136 AGATGTGTGATGCATTTTGAAGG + Intergenic
982713959 4:158787241-158787263 AAATGAGCTATGCATTTTGGAGG + Intronic
987946699 5:24619146-24619168 AGAGGTACCATTCATCTTGAAGG - Intronic
990129764 5:52566560-52566582 AGATGTACGGTGCTTCTTGGAGG + Intergenic
993523487 5:88934860-88934882 AACTCTGCCATTCATCTTGGTGG + Intergenic
995393025 5:111660267-111660289 AGATTAGCCAAGCATGTTGGTGG + Intergenic
996582041 5:125041942-125041964 AGATATGCCATGCTTCTTGTTGG + Intergenic
1002372765 5:178768284-178768306 ACATGTGCCACGAATCTTAGAGG - Intergenic
1003019761 6:2499494-2499516 AAATTTGCCATGCATGATGGTGG + Intergenic
1004420090 6:15461467-15461489 AGACTGGCCATGCATCTAGGAGG + Intronic
1005961126 6:30693940-30693962 AGATTTGCCAAGCATTTTGCTGG - Intergenic
1007418213 6:41704444-41704466 TGATGTGCCTAGCACCTTGGAGG + Intronic
1009572990 6:65413498-65413520 AGATATTCCTTGCATCTTTGAGG - Intronic
1020150884 7:5680887-5680909 AGATGTGAGGTGCATTTTGGAGG - Intronic
1022493570 7:30838883-30838905 AGATTTGCAAGGGATCTTGGAGG - Intronic
1026526686 7:71159687-71159709 AGATGCCCCAGGCATGTTGGGGG - Intronic
1029054498 7:97727125-97727147 AAATTTGCCAGGCATGTTGGTGG + Intergenic
1029648182 7:101871501-101871523 AGATGAAGCATGCATCTTAGAGG + Intronic
1032460086 7:132103712-132103734 AGATTTGAGCTGCATCTTGGAGG - Intergenic
1035589788 8:803560-803582 AGATGTGTGATGCTTCTCGGTGG - Intergenic
1036563010 8:9913506-9913528 AGATGAGCCATGGATGTTTGGGG + Intergenic
1038324501 8:26562378-26562400 AGATGTGTCATTTATGTTGGAGG - Intronic
1040687200 8:49888990-49889012 ATTTGTGTCATGCATTTTGGGGG - Intergenic
1041664412 8:60428843-60428865 AGATGTCTCATGCATCTAAGCGG - Intergenic
1045309809 8:100991374-100991396 GGACCTGCCATCCATCTTGGGGG - Intergenic
1046723458 8:117648594-117648616 TGATGTTTCATGCATCTTGTAGG - Intergenic
1046937214 8:119896007-119896029 AAATTAGCCATGTATCTTGGCGG - Intronic
1048477821 8:134758933-134758955 TGATGTGCCATGAATCATGATGG + Intergenic
1048759974 8:137783199-137783221 ATATTTGCCATGAATCTTTGAGG + Intergenic
1049202816 8:141350186-141350208 AAATGTGCAATGCATTTGGGAGG + Intergenic
1050327767 9:4514477-4514499 ACATGTCACATGGATCTTGGAGG + Intronic
1053151343 9:35745270-35745292 AAATGTGCCAGGCATGGTGGCGG - Intronic
1055500943 9:76901898-76901920 TGATGTGCCCTGTATCTTGCTGG + Intronic
1055631239 9:78226055-78226077 GGAAGTGTCATGCCTCTTGGAGG - Intergenic
1057642476 9:96837872-96837894 AAATGAGCCAGGCATCATGGTGG - Intronic
1058364609 9:104193931-104193953 AGATGTAGAATGCATCCTGGAGG + Intergenic
1058837754 9:108874512-108874534 AGTTATGCTTTGCATCTTGGGGG - Intronic
1060031894 9:120221865-120221887 AAATCTGCCATCCATCTGGGAGG - Intergenic
1060772458 9:126342530-126342552 TGCTGTGCCATGCATTTTAGTGG + Intronic
1062738953 9:138156073-138156095 AGGAGTGCCATGAATCTTGTGGG + Intergenic
1187060309 X:15780562-15780584 AAATGTTCCATGCAGCTGGGTGG - Intronic
1189176763 X:38965453-38965475 AGATGTGCCATGCTTATTCCTGG + Intergenic
1192845742 X:74905658-74905680 AGATTTGCCAGGCATCATGGCGG + Intronic
1193416552 X:81231208-81231230 AAATGTGCCATTCTTATTGGCGG - Intronic
1200617643 Y:5399648-5399670 AGATTTGCCAGGCATGGTGGTGG - Intronic