ID: 1068738932

View in Genome Browser
Species Human (GRCh38)
Location 10:60447143-60447165
Sequence AGTCACCCCCTTCCCTGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 168}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068738932_1068738934 -1 Left 1068738932 10:60447143-60447165 CCATTTCAGGGAAGGGGGTGACT 0: 1
1: 0
2: 3
3: 10
4: 168
Right 1068738934 10:60447165-60447187 TTGTGTGTTCAAAGACTAGAGGG No data
1068738932_1068738935 14 Left 1068738932 10:60447143-60447165 CCATTTCAGGGAAGGGGGTGACT 0: 1
1: 0
2: 3
3: 10
4: 168
Right 1068738935 10:60447180-60447202 CTAGAGGGCTTCCCTCAGAGAGG No data
1068738932_1068738933 -2 Left 1068738932 10:60447143-60447165 CCATTTCAGGGAAGGGGGTGACT 0: 1
1: 0
2: 3
3: 10
4: 168
Right 1068738933 10:60447164-60447186 CTTGTGTGTTCAAAGACTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068738932 Original CRISPR AGTCACCCCCTTCCCTGAAA TGG (reversed) Intronic
900593288 1:3469171-3469193 CATCACCCCCTTCTCTGACAAGG + Intronic
901530389 1:9849155-9849177 TGCCACCCCCTTCCCTGGGAGGG - Exonic
907769319 1:57444137-57444159 AGTCTCCCCCATCCCTCCAATGG + Intronic
908485462 1:64588049-64588071 ACTCATCCCCTGTCCTGAAAGGG - Intronic
908598300 1:65711532-65711554 ATTCACCCCCGACCCGGAAAGGG - Intergenic
919355639 1:196517789-196517811 AGTCACTGGCATCCCTGAAAGGG + Intronic
920218280 1:204377239-204377261 TTTCAGCTCCTTCCCTGAAAGGG - Intronic
920222257 1:204412235-204412257 AGTCATCCCCTCTCATGAAATGG + Intergenic
921417664 1:214909313-214909335 AGTCAAAACATTCCCTGAAAGGG - Intergenic
922660154 1:227422962-227422984 AGTCCCCCACTTATCTGAAAGGG + Intergenic
1065012989 10:21436390-21436412 AGTCACCCCCGGCCCTGAACTGG - Intergenic
1066222004 10:33344498-33344520 ACTCAACCCCTGCCCTGAAGGGG + Intergenic
1068738932 10:60447143-60447165 AGTCACCCCCTTCCCTGAAATGG - Intronic
1069955210 10:72046074-72046096 AGTCAGCCCCTTTCCTGAATGGG - Intergenic
1076090495 10:127681328-127681350 CGTCAGCTCCTTCCCTGTAACGG + Intergenic
1076409673 10:130236994-130237016 TGTCCCCACCTTCCCTGTAAAGG + Intergenic
1078840284 11:15071685-15071707 AGTCGCCCCCTCCCCTGGGAAGG - Intronic
1079575741 11:22001299-22001321 TGTCACCCCTTTCCTTGACAAGG - Intergenic
1080580940 11:33643223-33643245 AGTCTCCACCTTCCCAGCAAAGG + Intronic
1082076150 11:47977814-47977836 CTTCACTCCCTTTCCTGAAAAGG + Intergenic
1083685250 11:64371491-64371513 TGTGACCCCCTTCCCTCATAGGG + Exonic
1084473573 11:69376652-69376674 TGGCACCCCCTTCCCAGGAAGGG - Intergenic
1089583550 11:119496153-119496175 AGCCACCACCTTCCCTGCACGGG - Intergenic
1089616087 11:119695581-119695603 AGGCACCCCCATCCCTGAGTTGG - Intronic
1090718439 11:129451411-129451433 AGTCTCCCTCTTCCCTCAAAAGG - Exonic
1091852792 12:3713745-3713767 AATCACTGCCTTCCCTGAGAAGG + Intronic
1094309631 12:29065348-29065370 ATGCACCCCCTACCCTGTAATGG + Intergenic
1098612952 12:72484980-72485002 CGTCACCCCATTCCCTGAGTTGG + Intronic
1098796399 12:74893781-74893803 CGTCATCCACTTCCCTGCAAAGG - Intergenic
1101817088 12:108153589-108153611 ATTCACCCCCAAGCCTGAAAAGG + Intronic
1103235622 12:119370070-119370092 AGTGACCACCTTTCCTGAAGCGG - Intronic
1109320665 13:60805778-60805800 AGTCACCCCTTTCCTTGACCAGG + Intergenic
1112153957 13:96797147-96797169 AGTCACCCAGTTCCCAGACAAGG + Intronic
1113444674 13:110356249-110356271 GGTCACCCACTTGCCTGAATAGG + Intronic
1113615833 13:111680212-111680234 TTTCTTCCCCTTCCCTGAAAAGG + Intergenic
1113621301 13:111765105-111765127 TTTCTTCCCCTTCCCTGAAAAGG + Intergenic
1118322037 14:64758948-64758970 CCCCACCCCCTTCCCTGATAAGG - Intronic
1118974475 14:70665003-70665025 AGCCTCCCCCTTCCCACAAAGGG - Intronic
1119213789 14:72852447-72852469 TCACACCCCCTTGCCTGAAATGG + Intronic
1122123426 14:99566673-99566695 AGGCACCTGCTACCCTGAAAAGG + Intronic
1127368337 15:58311757-58311779 AATCCCCACCTTCCCTGCAAGGG - Intronic
1128329877 15:66748676-66748698 AGGAACTCCCTCCCCTGAAAGGG - Intronic
1130006710 15:80106734-80106756 AGTAACCCTTTTCCCTGAAATGG + Intronic
1130870671 15:87969312-87969334 AGTTACCTCTTTCCCTTAAAGGG - Intronic
1130901207 15:88208030-88208052 TGTCACCCCACTCCCTGCAATGG + Intronic
1133227791 16:4350829-4350851 GGTCAGCCACTTCCCTGGAAAGG + Intronic
1133568601 16:7019653-7019675 AGTCACACCTTTCCCAGTAATGG - Intronic
1133833911 16:9350402-9350424 AGGCACCCACTTCCCAGACAGGG + Intergenic
1133833944 16:9350512-9350534 AGGCACCCACTTCCCAGACAGGG + Intergenic
1134184754 16:12076066-12076088 TGTCACCCCTTTCCTTGAACAGG + Intronic
1135021864 16:18969509-18969531 AGCCACCCCCTTCTCTGATGGGG - Intergenic
1136106424 16:28033401-28033423 AGTCACCCACTTCCCTCCCAGGG - Intronic
1138577171 16:57915410-57915432 AGTCTCTCCCTTCCATGGAAAGG + Intronic
1143120041 17:4600700-4600722 ACTCAGCCCCTTCCATAAAAGGG - Intronic
1144327256 17:14193988-14194010 AGACACCCCCATCCCTGGCAGGG + Intronic
1147301657 17:39533660-39533682 ACTCACCCCCTTCCCTAGTAGGG - Exonic
1147357688 17:39910611-39910633 AGACACCCTCTTCTCTGACAAGG + Intronic
1150348168 17:64420873-64420895 CAGCACCCCCTTCCCTGAAGGGG + Intergenic
1150770522 17:68036922-68036944 AGTGTCCCCCTTCCCTCTAAAGG - Intronic
1152366417 17:79859181-79859203 CCTCACTCCCTCCCCTGAAAGGG - Intergenic
1153689824 18:7580972-7580994 AATCACACCTTTCCCTGAACCGG - Intronic
1155525998 18:26716827-26716849 AGCCTCCCACTCCCCTGAAAGGG - Intergenic
1156335177 18:36165166-36165188 AGTCACCTCCTTCATTGAGAAGG + Intronic
1157347281 18:46851026-46851048 AGGCACCTCCTTACCTGAGAAGG - Intronic
1160793762 19:934521-934543 AGTGACCCCCCTCCCTGCACTGG - Intronic
1161434831 19:4256975-4256997 AGTCACCTCCACCCCTTAAATGG + Intronic
1161437662 19:4273312-4273334 TGTCACCCCATTCCCAGATAAGG - Intergenic
1163824568 19:19515766-19515788 ACTCACCCCAATCCCTGGAACGG - Exonic
1165322908 19:35097180-35097202 AGTCTTCCCCATCCGTGAAAGGG - Intergenic
1167244350 19:48364735-48364757 TGTCACCCCCAAACCTGAAAGGG + Intronic
1167723223 19:51193199-51193221 GCTCTCCCTCTTCCCTGAAACGG + Intergenic
925324936 2:3011627-3011649 ACTCACCTCCTTCCCAAAAAAGG + Intergenic
925731014 2:6919147-6919169 AGACACCCCCTCCCTTGCAAAGG - Intronic
927488365 2:23504585-23504607 AGGCCCAGCCTTCCCTGAAAGGG + Intronic
928052902 2:28019149-28019171 ATTCACCCATGTCCCTGAAAAGG + Intronic
932805173 2:74777324-74777346 ACACACCTCCTTCCCTGAGATGG + Intergenic
933671748 2:85014522-85014544 AATCATCACCTTCCCTTAAAAGG + Intronic
934473670 2:94578130-94578152 TGTCACCCTCTGCCCAGAAAGGG + Intergenic
935798995 2:106673768-106673790 AGTCATCCACATCCCTGCAAAGG + Intergenic
937470045 2:122166823-122166845 ACTCACCCCCTCCCCCGAAGTGG + Intergenic
940022247 2:149167634-149167656 AGTCATCCTCCTTCCTGAAAGGG + Intronic
941708567 2:168687007-168687029 AGTCACCACTGGCCCTGAAATGG - Intronic
942622010 2:177854808-177854830 AGCCACCTCCTTGCCAGAAAGGG + Intronic
942894596 2:181036682-181036704 AGCCACCCTCTACCCTGAACTGG + Intronic
944220567 2:197300306-197300328 AGTCACCAGGTTACCTGAAAGGG + Intronic
944378087 2:199072375-199072397 AATCACCACATTCCTTGAAATGG - Intergenic
944785676 2:203067058-203067080 AGGCACCCACTTCCCAGACAGGG + Intronic
947462996 2:230319353-230319375 AGTAACCCCCTTCCCTGAACAGG - Intergenic
948387391 2:237589882-237589904 AATCAGACCCTTCCCTGGAATGG - Intronic
1170577201 20:17673318-17673340 AGTCACCTCCTGACCTGACAGGG + Intronic
1171257218 20:23698567-23698589 AGTGACCCCCTGCACTGCAAAGG + Intergenic
1171262470 20:23746568-23746590 CTGCACCCCCTGCCCTGAAATGG + Intergenic
1171271566 20:23822287-23822309 CTGCACCCCCTGCCCTGAAATGG + Intergenic
1174683560 20:52431595-52431617 AGTCACCTCCCTCCCTCAACAGG + Intergenic
1177777884 21:25589777-25589799 AGTCAGCTCTTTCCCTGGAAGGG - Intronic
1179530638 21:42016427-42016449 AGTTACCCCCTTCCATGCAGTGG + Intergenic
1179709939 21:43207570-43207592 AGCCACCCCCTTCTCTTAAACGG + Intergenic
1182515611 22:30857163-30857185 AGTCACCCCCATCGCTTAGAGGG - Intronic
1182736741 22:32536203-32536225 AGTCACCTCCTTCCCCCAACAGG - Intronic
1184886999 22:47352474-47352496 AGTCACTCCCTTCCCTGACAGGG + Intergenic
1185184585 22:49391430-49391452 TGTCACCCTCTCCTCTGAAAGGG + Intergenic
953305045 3:41821361-41821383 TATCACCACCCTCCCTGAAAAGG + Intronic
957393588 3:79611729-79611751 AGTCCCCCCACTCCCTGACAAGG - Intronic
958406241 3:93761238-93761260 AGGCACCCACTTCCCTGATGGGG + Intergenic
958406601 3:93762479-93762501 AGGCACCCACTTCCCTGATGGGG + Intergenic
958745956 3:98134842-98134864 AGTCACTCACTTCCCCAAAATGG + Intergenic
959300828 3:104598777-104598799 AATCATAGCCTTCCCTGAAATGG - Intergenic
960543876 3:118889872-118889894 AGTCACTCCCTTCCAGGAAAAGG - Intergenic
962361384 3:134745830-134745852 CGTCACCCATGTCCCTGAAAAGG + Intronic
964800813 3:160555391-160555413 AGTCACCCCCTTATCTGCACAGG + Intronic
968585836 4:1415548-1415570 AGTCACCCCCTCCTCTTGAACGG + Intergenic
968899722 4:3425630-3425652 ACTCACCCCCTCCCCTGCACCGG - Intronic
968899960 4:3426291-3426313 ACTCACCCCCTCCCCTGCACTGG - Intronic
971743226 4:30546625-30546647 AATCACCCCCTTCCCTCCACAGG + Intergenic
973541560 4:51940858-51940880 AGTCACCCCTTTCCTTGACTAGG + Intergenic
974851809 4:67412728-67412750 AATCATTCACTTCCCTGAAAAGG - Intergenic
981544987 4:145884405-145884427 GGTCACCACCTTCCTTTAAATGG - Intronic
982345462 4:154352882-154352904 AGTCTGCCCCTACCCTCAAATGG - Intronic
982965328 4:161899678-161899700 TGTCTCCCCCTTCCCCAAAATGG - Intronic
986385631 5:7230823-7230845 TGTCACCCCCTTCTCTGACTAGG - Intergenic
986434241 5:7712412-7712434 AGTCATCCCCATCACTGAACTGG - Intronic
988043388 5:25916536-25916558 AGTCACTAGCATCCCTGAAAGGG + Intergenic
989166271 5:38436389-38436411 AGTCCCTCCTTTCACTGAAAAGG + Intronic
989196963 5:38725474-38725496 ATTCATCCCCTTGGCTGAAAAGG + Intergenic
989509093 5:42263167-42263189 AGTCACTCATTACCCTGAAATGG + Intergenic
989802990 5:45567332-45567354 AGTCACCCCATTCCTTTACATGG - Intronic
990061285 5:51652044-51652066 AGTCACTCTCAGCCCTGAAAAGG - Intergenic
997069620 5:130605782-130605804 TGTCACTCCCTTCTCTGTAAAGG + Intergenic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
999550976 5:152686984-152687006 ACACATCCCTTTCCCTGAAAGGG + Intergenic
1002168801 5:177363883-177363905 AGCCACCACCTTCCCCAAAAGGG - Intronic
1005202879 6:23366848-23366870 AGACACCCCATTTCCTGAGATGG - Intergenic
1008890364 6:56481812-56481834 AGTAACTACCTTCCCTGAAAAGG + Intronic
1011340468 6:86307759-86307781 TGACAGCCCCTTTCCTGAAATGG - Intergenic
1014876985 6:126673779-126673801 AGTCACCCCCTTCTTTGACTAGG - Intergenic
1014945046 6:127487650-127487672 ATTCACTCTCTTCCCTAAAAGGG + Intronic
1016278680 6:142386746-142386768 AGCCACCCGCTACCCTGAACTGG - Intronic
1017123306 6:151044250-151044272 TGTCACCCTCTGCCCAGAAAGGG - Intronic
1019015634 6:168877869-168877891 AGCCACCGCCTGCCCTTAAAAGG - Intergenic
1023666001 7:42524174-42524196 TATCATCCCCTTTCCTGAAAAGG - Intergenic
1024171064 7:46787203-46787225 AGTCACCTCTGTCCCTGACAGGG + Intergenic
1024673868 7:51620844-51620866 AGTCACCAGCTTCCTTGGAAAGG + Intergenic
1026146218 7:67749028-67749050 AGTCATACCCTTACCTCAAAAGG - Intergenic
1027112602 7:75452816-75452838 CTTCACCCTCTTCCCTGAAGAGG + Intronic
1027284848 7:76637422-76637444 CTTCACCCTCTTCCCTGAAGAGG + Intergenic
1037754652 8:21703061-21703083 GACCACCCCCTTCCCTGGAATGG + Intronic
1038858452 8:31359279-31359301 AGTCACCCCCTTATCTAAAGGGG + Intergenic
1040008679 8:42642800-42642822 GGTCGCCCCCTTCACTGAGATGG + Intergenic
1041472601 8:58227169-58227191 AGTCACTTCCTTACCTGGAAAGG - Intergenic
1041756057 8:61314185-61314207 AGTGTCCCCTTTCCCTGACAGGG + Intronic
1041859775 8:62500029-62500051 AGTGAACCTCTTCACTGAAATGG + Intronic
1042401356 8:68351579-68351601 AGTCACTGGCATCCCTGAAAGGG - Intronic
1047494827 8:125402077-125402099 AGTCACTCACTCCACTGAAATGG + Intergenic
1050537304 9:6642132-6642154 AGTCCCCCCATTCCCTGAAATGG - Intronic
1053684660 9:40510382-40510404 TGTCACCCTCTGCCCAGAAAGGG - Intergenic
1053934626 9:43138660-43138682 TGTCACCCTCTGCCCAGAAAGGG - Intergenic
1054279066 9:63114583-63114605 TGTCACCCTCTGCCCAGAAAGGG + Intergenic
1054297754 9:63345844-63345866 TGTCACCCTCTGCCCAGAAAGGG - Intergenic
1054395770 9:64650355-64650377 TGTCACCCTCTGCCCAGAAAGGG - Intergenic
1054430414 9:65155550-65155572 TGTCACCCTCTGCCCAGAAAGGG - Intergenic
1054499966 9:65865971-65865993 TGTCACCCTCTGCCCAGAAAGGG + Intergenic
1055306522 9:74935047-74935069 AGCCACCCCCTCTCCTGGAAGGG - Intergenic
1055687289 9:78790267-78790289 ATTCACTCCTTTGCCTGAAATGG - Intergenic
1056543240 9:87592331-87592353 TTTCACCCCCTTCCCTGCCAGGG + Intronic
1058071498 9:100605170-100605192 AGTCCCCCCCTTATCTGCAAGGG - Intergenic
1058198600 9:102009836-102009858 ATACACTCCCTTCCCTGAAAGGG + Intergenic
1060342626 9:122790357-122790379 AGCCATCCACGTCCCTGAAAAGG - Intergenic
1060596368 9:124851578-124851600 TGTCACTCCATTCCCTGAAGGGG - Intergenic
1062118652 9:134822388-134822410 AGTGGCCTCGTTCCCTGAAATGG - Intronic
1062161721 9:135083992-135084014 CCTCACCCCCTTCCCTGGAGAGG - Intronic
1186441918 X:9593886-9593908 GGTCACCCCCTCCACTGCAAGGG + Intronic
1186525547 X:10244855-10244877 AGCCACCCCCTTCCCGGAGAGGG + Intergenic
1187092827 X:16115314-16115336 AGTGAAACTCTTCCCTGAAAGGG - Intergenic
1187968054 X:24632055-24632077 AGTCACCCATTACCCTGAACTGG + Intronic
1189447136 X:41090680-41090702 ATTCTCCCCTTTCCCTAAAAGGG - Intronic
1193287668 X:79731938-79731960 AGACACACCCTACCCTGAAAGGG + Intergenic
1193789706 X:85802502-85802524 AATCAACAGCTTCCCTGAAATGG - Intergenic
1194266542 X:91760560-91760582 TGTCACAACTTTCCCTGAAAGGG + Intergenic
1195538522 X:106036204-106036226 TGTCACCCACCTCTCTGAAAGGG + Intronic
1196010922 X:110887267-110887289 AGTCTCCCTCTTACCTGACAGGG - Intergenic
1198040283 X:132844257-132844279 AGTCAGTGGCTTCCCTGAAAAGG - Intronic
1200779998 Y:7206084-7206106 AGTCACCTCCATCCCCTAAATGG - Intergenic