ID: 1068739468

View in Genome Browser
Species Human (GRCh38)
Location 10:60452144-60452166
Sequence CTGTGTGCACCGCTAGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068739468_1068739472 10 Left 1068739468 10:60452144-60452166 CCAGCCTCTAGCGGTGCACACAG 0: 1
1: 0
2: 1
3: 9
4: 112
Right 1068739472 10:60452177-60452199 CAGAGTGGACTGATCAGCTCTGG No data
1068739468_1068739470 -5 Left 1068739468 10:60452144-60452166 CCAGCCTCTAGCGGTGCACACAG 0: 1
1: 0
2: 1
3: 9
4: 112
Right 1068739470 10:60452162-60452184 CACAGTGCAAACCAGCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068739468 Original CRISPR CTGTGTGCACCGCTAGAGGC TGG (reversed) Intronic
902644061 1:17785920-17785942 CTGTGTTCTCATCTAGAGGCTGG + Intronic
903696764 1:25213300-25213322 TGGTGTGCACCTATAGAGGCAGG + Intergenic
903830480 1:26171329-26171351 CTCTGTGCACCTCCAGATGCAGG - Exonic
907323194 1:53618581-53618603 CCCTGTGCACAGCTACAGGCAGG - Intronic
911755316 1:101547393-101547415 TTGTGTGCAATGCTAGAGGGAGG + Intergenic
912492274 1:110069050-110069072 CGGTGAGCACCGCCAGAGACAGG - Intronic
915311571 1:155008132-155008154 CTGTGGGCACCGAAAGAGGAAGG - Intronic
917517368 1:175719233-175719255 CTGTGTGCAGCCCAAGAGGTGGG - Intronic
920430792 1:205917572-205917594 CTTTGTGGGCCGTTAGAGGCAGG + Intronic
920534963 1:206731428-206731450 CTGTGTGGAGGGCTGGAGGCAGG + Intronic
924598103 1:245464876-245464898 CTATGTGCAGAGCCAGAGGCCGG + Intronic
1062830123 10:599925-599947 CTGTGTACACCTCAAGAGGCCGG + Intronic
1063020086 10:2118427-2118449 CAGTGTGCACAGGCAGAGGCAGG - Intergenic
1064143723 10:12810944-12810966 CTGTGAGCACCTCTAGACCCAGG + Intronic
1064507517 10:16049373-16049395 CTGTGTCCACCGGAATAGGCTGG - Intergenic
1065720777 10:28626960-28626982 CTGTGTCCAGCACTAGAGGAAGG + Intergenic
1068739468 10:60452144-60452166 CTGTGTGCACCGCTAGAGGCTGG - Intronic
1073025408 10:100483728-100483750 TGGTCTGCACCTCTAGAGGCAGG + Exonic
1073347663 10:102796442-102796464 CTGTCTACAGGGCTAGAGGCTGG - Intronic
1073472118 10:103729259-103729281 CTGTGGGTAAAGCTAGAGGCAGG - Intronic
1077475932 11:2790487-2790509 CTGTGTGCACAGCTGGATGCTGG - Intronic
1080222321 11:29920464-29920486 ATGTGGGCACCACTAGAAGCTGG + Intergenic
1081660761 11:44886944-44886966 CTGTGTGTAGAGCAAGAGGCTGG + Intronic
1082771427 11:57210796-57210818 CTGTCTGCACCGTTGGAGGATGG - Intergenic
1083690489 11:64405383-64405405 CTGTATGCACAGCTAGTAGCTGG + Intergenic
1084218246 11:67663184-67663206 CTGTGTGACCCGTTGGAGGCGGG + Exonic
1089001988 11:115059856-115059878 CTGTTTGTACTGCTGGAGGCTGG - Intergenic
1089347836 11:117802444-117802466 CTGAGTGTACCCCTAGAGCCAGG - Intronic
1090432374 11:126656821-126656843 GTGTGTGCATCGCTTGGGGCTGG + Intronic
1096559919 12:52428789-52428811 CTGTGTGCACAGCGAGTGCCTGG - Intronic
1103065025 12:117890325-117890347 CTGTGGACACCCCTAGAGGCTGG - Intronic
1104432271 12:128726122-128726144 ATGTGGGCGCCTCTAGAGGCTGG + Intergenic
1108518353 13:51222842-51222864 TTGTCTGCATCGCTAGAGACAGG + Intronic
1111125380 13:83907314-83907336 CTGTGTGCTCTGCCAGAGACAGG - Intergenic
1113308626 13:109106870-109106892 CTGTGTGTCCCGTTTGAGGCAGG + Intronic
1113788891 13:113016918-113016940 CTGGGTGCACCTCTAGAAGCCGG - Intronic
1116022681 14:39480960-39480982 CTGTGTGCACTTCTTGAGACTGG + Intergenic
1120313457 14:82861033-82861055 GTGTGTGCAACCCTTGAGGCAGG + Intergenic
1120744745 14:88143173-88143195 CTGTATGCTCCCCTAGAGGCTGG + Intergenic
1121314548 14:92953253-92953275 CTCTGTGCCCCGCTAGCGGGAGG - Intronic
1122202261 14:100129737-100129759 CTCTGTGCAGCGCTGGGGGCGGG - Intronic
1122397058 14:101441290-101441312 CTGAGCCCACCTCTAGAGGCTGG + Intergenic
1122605386 14:102944606-102944628 CTGTGTGCACAGCCTGAGCCCGG + Intronic
1127075450 15:55321130-55321152 TGGTGTGCACCTGTAGAGGCAGG + Intronic
1127250230 15:57227340-57227362 CTCTGTTCAGCTCTAGAGGCTGG - Intronic
1128720063 15:69941596-69941618 CTGTGTCCAAAGCTACAGGCAGG + Intergenic
1135415813 16:22267222-22267244 CTGTGTGTATCCCTAGTGGCTGG + Intronic
1136384511 16:29914794-29914816 CAGTGTGCAGTGGTAGAGGCAGG + Intronic
1137024503 16:35459343-35459365 CTGTGTGCAGCCCTACAGGAAGG + Intergenic
1141854683 16:86673036-86673058 ATGTGGGCACCCCTAGAAGCTGG + Intergenic
1145941998 17:28747464-28747486 CTCTGTGCACCCCTACAGGCTGG - Intronic
1148738084 17:49875970-49875992 CTGCTTGCTCCCCTAGAGGCTGG + Intergenic
1151727587 17:75893711-75893733 CTGTGTGAAATGCTGGAGGCTGG - Intronic
1151816490 17:76473867-76473889 ATGTGGGCACCGCTGGAGGCTGG + Exonic
1152230010 17:79109726-79109748 CTGTGTGCCCCTCTCCAGGCTGG - Intronic
1155511199 18:26579154-26579176 CTGTGTGCCCAGCTAGGTGCTGG - Intronic
1156651364 18:39230255-39230277 CTGTGTGCACAGCCAGATCCAGG - Intergenic
1157354113 18:46917545-46917567 CAGGGGGCACCGCTAGGGGCGGG - Intronic
1161586415 19:5108139-5108161 CTGTGTGCACCCGTGGAGGGGGG - Intronic
1162712882 19:12609290-12609312 CTGTGTGTACAGGTAGATGCAGG - Intronic
1164574195 19:29396194-29396216 CTGGGTGCCACCCTAGAGGCTGG - Intergenic
1166659589 19:44637669-44637691 CTGTGGTCACCTCTTGAGGCAGG - Intergenic
1167063887 19:47169634-47169656 CTGTGTGCTTCTGTAGAGGCTGG - Intronic
928194140 2:29202160-29202182 CAGTGTGAACAGCCAGAGGCAGG - Intronic
930454061 2:51582204-51582226 CTATGTGCTCCCCTAGAGGTTGG + Intergenic
930845089 2:55895202-55895224 CTGTGTGCACAGTCACAGGCAGG - Intronic
931170638 2:59799977-59799999 CTGTGTGCACCTCTACCGGGAGG - Intergenic
931709327 2:64974642-64974664 CTGTGTGCAGGGTTAGGGGCTGG - Intergenic
938950350 2:136249395-136249417 CTGTGGGCACAGGGAGAGGCAGG + Intergenic
939228016 2:139388142-139388164 CTGTGTGCACTGCTGGTGACTGG - Intergenic
941978621 2:171431958-171431980 CTCCGTGCACCGCTTGCGGCTGG - Intronic
943564208 2:189498381-189498403 ATGTCTGCACAGCCAGAGGCTGG - Intergenic
1172771583 20:37385398-37385420 CTGTCTGCACCGCTGGGGCCCGG - Intronic
1172902791 20:38347064-38347086 TTGTGGTCACCTCTAGAGGCAGG + Intronic
1173595945 20:44258411-44258433 CTGTGGGCACCGCCAGGGGCTGG - Intronic
1174985905 20:55451731-55451753 CTGTGTGAACCCCTAGAGAAAGG - Intergenic
1175626341 20:60491064-60491086 CTGTCTGCACCACCAGAGCCGGG + Intergenic
1175744861 20:61449102-61449124 CTGTGTGCAGTGCCAGGGGCTGG + Intronic
1176201341 20:63862105-63862127 CTGTCTGCACCGCTCGAGGCCGG + Exonic
1180626216 22:17195204-17195226 CTATGTGCACAGATAGATGCAGG - Intronic
1182226439 22:28802031-28802053 CTGTTTGCACCCCTAGAACCTGG - Intergenic
1184413098 22:44337161-44337183 CTGAGGGTACCACTAGAGGCTGG - Intergenic
1184682328 22:46079040-46079062 CTGGGTGGACCGCGAGAGCCCGG - Intronic
1185148475 22:49151617-49151639 CTGTGTGTCCCACTGGAGGCAGG + Intergenic
1185165917 22:49262165-49262187 CTGTGTGCTCCGGTACAGGCTGG + Intergenic
1185294554 22:50046781-50046803 CTTTGTGCAGGGCTGGAGGCCGG + Intronic
950105850 3:10387975-10387997 CTGTTTCCACCACTTGAGGCTGG + Intronic
950508944 3:13414228-13414250 CTTTGGGCACCGTTAGGGGCTGG - Intronic
950655300 3:14432748-14432770 CTGTTTCCACAGCCAGAGGCAGG - Intronic
951334721 3:21406474-21406496 CTGTGTGCTCTGCCAGAGACAGG + Intergenic
952842698 3:37661766-37661788 CTGTGAGCAGAGCAAGAGGCTGG + Intronic
961518928 3:127455873-127455895 CAGTGAGCACCTGTAGAGGCTGG - Intergenic
966294415 3:178402295-178402317 CTGGGTGCAAGGCAAGAGGCTGG - Intergenic
969401254 4:6957073-6957095 CTGTGTGCTCCTCTTGAGGGTGG + Intronic
969428143 4:7137883-7137905 TGGTGGGCACCGCGAGAGGCTGG + Intergenic
970419847 4:15895650-15895672 CTGTGAGCACCACAAGAGGAGGG + Intergenic
970486161 4:16526719-16526741 ATGTGTACACCTCTAGAAGCTGG + Intronic
985947160 5:3194809-3194831 CTGTCTGCACCCCCAGAGGACGG + Intergenic
988996806 5:36722796-36722818 CTGTATGCACCAATAGATGCCGG - Intergenic
989256490 5:39371274-39371296 CTGTGTGGACTGCTCTAGGCTGG - Intronic
1000791927 5:165618685-165618707 GTGTGTGCATCACTTGAGGCTGG - Intergenic
1006211930 6:32403137-32403159 TTGTGTGCACTGCAAGGGGCTGG - Exonic
1016833450 6:148454715-148454737 CTGTGTGCATCACAGGAGGCAGG + Intronic
1016843647 6:148548864-148548886 CTCTGTGTACTGGTAGAGGCTGG + Exonic
1018420686 6:163638377-163638399 CTCTGTGCACCACAAGAAGCAGG + Intergenic
1023024482 7:36038402-36038424 CTGGGTCCACTGCTGGAGGCAGG - Intergenic
1031206814 7:118769474-118769496 CTGTGTACAAGGCTAAAGGCTGG - Intergenic
1033641952 7:143269702-143269724 CAATGGGCACAGCTAGAGGCAGG - Intronic
1034904474 7:154932285-154932307 CTGTGTGCACGGCTGCATGCAGG - Intronic
1037673864 8:21037968-21037990 CTGTGTTCACAGCTTTAGGCTGG - Intergenic
1037879329 8:22565460-22565482 CGGTGCGCGCCGCTGGAGGCCGG - Intronic
1051535644 9:18154414-18154436 CCGTAGGCACAGCTAGAGGCTGG + Intergenic
1053304029 9:36971274-36971296 CTGTGTGCGACACCAGAGGCAGG - Intronic
1058197601 9:101997949-101997971 CTGAGTGCTCAGCTAGAGGTTGG + Intergenic
1059322659 9:113481547-113481569 CTGTTTGCACAGCTGGAGTCAGG - Intronic
1060812671 9:126618908-126618930 CTTTGTGCACGGCGAGACGCGGG + Intronic
1061257392 9:129460594-129460616 CTCTGTGCGCCGCGAGAGGGAGG + Intergenic
1061918497 9:133769560-133769582 CGGTGGGCACAGCTACAGGCCGG + Intronic
1189619263 X:42818450-42818472 CTCTGTGCAGTGCTTGAGGCTGG + Intergenic
1190914350 X:54799270-54799292 CTGTGTGGATGGGTAGAGGCCGG - Intergenic
1195596272 X:106693781-106693803 CTGTGTGTACAGCTGGAGGAGGG + Intronic
1196199433 X:112868884-112868906 CTGAGTTCACTGATAGAGGCTGG - Intergenic
1199581809 X:149368135-149368157 CCGTGTGCACGCCTAGAAGCAGG - Intergenic