ID: 1068744211

View in Genome Browser
Species Human (GRCh38)
Location 10:60511357-60511379
Sequence ATGCGACTACAAAACTGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068744210_1068744211 15 Left 1068744210 10:60511319-60511341 CCGTGAAAGGATAAAAGAGGAAT 0: 1
1: 0
2: 2
3: 48
4: 392
Right 1068744211 10:60511357-60511379 ATGCGACTACAAAACTGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068744211 Original CRISPR ATGCGACTACAAAACTGAAA AGG Intronic
No off target data available for this crispr