ID: 1068746554

View in Genome Browser
Species Human (GRCh38)
Location 10:60538223-60538245
Sequence CTGTTATCCTTGTTCACCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 127}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068746554 Original CRISPR CTGTTATCCTTGTTCACCAC TGG (reversed) Intronic
902281909 1:15381007-15381029 CTGTTGTCATTTTTCACCCCCGG + Intronic
904390626 1:30183260-30183282 CTATTGTCCTGGTTCACCCCTGG - Intergenic
904862948 1:33553196-33553218 CTGTTAGGCTTGCTCAACACAGG - Intronic
906811207 1:48828676-48828698 CAGTAATGCTTGTTCACAACAGG + Intronic
907632665 1:56098833-56098855 CTGTTATCATTTTTCACCACAGG - Intergenic
908267483 1:62393669-62393691 CTCTTCTCATTCTTCACCACTGG + Intergenic
915230814 1:154444109-154444131 CTGACATCCTTGTGCACAACTGG + Intronic
915265454 1:154713533-154713555 CTGTTACCATTCTTCCCCACAGG - Exonic
915639903 1:157216436-157216458 CTGTTTTCCTTGCTCTCCATGGG + Intergenic
916983474 1:170165540-170165562 CAGTTAGCATTGTTCACCTCAGG + Intronic
917035883 1:170746412-170746434 CTGCTGTCCTTGCTCCCCACGGG - Intergenic
920666971 1:207970155-207970177 CTGTTACCCTAGTTGGCCACCGG - Intergenic
922248156 1:223820629-223820651 CTGGTTTCCTTTTTCACCTCTGG - Intronic
923323727 1:232861613-232861635 CTGTTATCCTTGAGCATCCCTGG - Intergenic
924282794 1:242454937-242454959 CTGTTCTTCTTTTTTACCACAGG + Intronic
1063330719 10:5156241-5156263 CTGTTCTACTTGCTCACCTCAGG + Intergenic
1065916407 10:30357735-30357757 GTTTTATCCTAGATCACCACTGG - Intronic
1066475668 10:35745396-35745418 CTGGTATAGTTATTCACCACAGG - Intergenic
1068746554 10:60538223-60538245 CTGTTATCCTTGTTCACCACTGG - Intronic
1071878655 10:89870355-89870377 TTGTTTACCTTGTTTACCACAGG + Intergenic
1072730875 10:97845790-97845812 CTCTTCCCCTTGTTCACCTCAGG + Intergenic
1082058734 11:47842516-47842538 CAGATGTCCTTGTTCCCCACTGG + Intronic
1084315954 11:68345783-68345805 CTGGAACCCTTGTGCACCACTGG - Intronic
1086117241 11:83265979-83266001 CTCTTATTCTGGTTTACCACAGG - Exonic
1087344025 11:96947466-96947488 GTGATATCCTTGTTGACCATAGG + Intergenic
1090661719 11:128887098-128887120 CTGTTTGTCTTGTTCACCTCTGG - Intergenic
1093065049 12:14649013-14649035 CTGTTTTCCTTGTTGAGAACAGG + Intronic
1093798394 12:23341383-23341405 TTGTTATTCTTCTTCACAACTGG + Intergenic
1094844326 12:34354829-34354851 CTGTTTTCCTGCCTCACCACAGG + Intergenic
1094846357 12:34363109-34363131 CTGTTTTCCTTGCACAACACAGG + Intergenic
1094851774 12:34385504-34385526 CTGTTTTCCTTCCACACCACAGG + Intergenic
1096542870 12:52317970-52317992 CTGTTCTCCCTGCTCACCTCAGG - Exonic
1099280036 12:80632172-80632194 CTGTTATCCCTCTTCTCCAGGGG + Exonic
1109666116 13:65540459-65540481 CAGTTTTTCTTGTTCACCTCTGG + Intergenic
1110237086 13:73228178-73228200 CTGTTGTCCTTGTTGGCCATTGG + Intergenic
1111175990 13:84596958-84596980 CTGTTATCCCTGCTCTCAACTGG - Intergenic
1113948250 13:114056992-114057014 CTGTTGTCCTTGGGAACCACGGG + Intronic
1123927049 15:25125515-25125537 TTGTTATTCTTGTTCACAAGTGG + Intergenic
1125340562 15:38671551-38671573 CTGTTATCCTGGTTCAACGGAGG - Intergenic
1126391730 15:48163196-48163218 GTGTTATCCTTCTTCCCCAAAGG - Intronic
1129403771 15:75301174-75301196 ATTTTATCCTAGATCACCACTGG + Intergenic
1129727444 15:77908825-77908847 GTTTTATCCTAGATCACCACTGG - Intergenic
1130270204 15:82442224-82442246 CTTTTATCCTAGATCACCACTGG + Intergenic
1130275764 15:82475605-82475627 CTTTTATCCTAGATCACCACTGG - Intergenic
1130282837 15:82532661-82532683 CTTTTATCCTAGATCACCACTGG + Intergenic
1130462545 15:84169545-84169567 CTTTTATCCTAGATCACCACTGG + Intergenic
1130468126 15:84202997-84203019 CTTTTATCCTAGATCACCACTGG - Intergenic
1130490132 15:84425248-84425270 CTTTTATCCTAGATCACCACTGG - Intergenic
1130496140 15:84470545-84470567 CTTTTATCCTAGATCACCACTGG + Intergenic
1130501719 15:84503998-84504020 CTTTTATCCTAGATCACCACTGG - Intergenic
1130590419 15:85207595-85207617 CTTTTATCCTAGATCACCACTGG - Intergenic
1137295527 16:47089161-47089183 CTGTTAAGCTTGTTCACCTGCGG + Intronic
1137770390 16:51011881-51011903 TTGTTTCTCTTGTTCACCACTGG + Intergenic
1141011523 16:80404921-80404943 CTTTTCTCCTTGTCCACCACAGG - Intergenic
1141869814 16:86777409-86777431 CATTTTTCCTTTTTCACCACGGG + Intergenic
1152108716 17:78345222-78345244 CTGTTAGCCTTGATCTCCCCAGG - Intergenic
1152756400 17:82088812-82088834 CTGTGATCCTTCTTCATCAGGGG + Exonic
1154555687 18:15750192-15750214 ATATTTTCCTTGTTCACCATAGG - Intergenic
1154915362 18:20718459-20718481 ATATTTTCCTTGTTCACCATAGG - Intergenic
1156761035 18:40590759-40590781 CTGTTTTCCTTCTTCACTGCTGG - Intergenic
1157665910 18:49486960-49486982 CTGTATTCTTTGTCCACCACCGG - Intronic
1158706108 18:59793725-59793747 CTGTTATTCTTGCTAACCATGGG + Intergenic
1159113646 18:64088993-64089015 CTGTGATCATAGCTCACCACAGG - Intergenic
1163839269 19:19595917-19595939 CTTTAATTCTAGTTCACCACAGG - Intronic
1164760160 19:30722633-30722655 CTGTTATCCCTGCCCACAACTGG - Intergenic
1164956923 19:32394345-32394367 CTGGTACCCTTGTGCACCATTGG + Intergenic
1168038904 19:53742323-53742345 AGGTTAGCCTTGTTCACCAAGGG - Intergenic
1168040378 19:53753828-53753850 AAGTTAGCCTTGTTCACCAAGGG - Intergenic
926312457 2:11684561-11684583 TTATTTTCTTTGTTCACCACGGG - Intronic
929236418 2:39610044-39610066 CTGAGATCCATGTTCACCTCAGG - Intergenic
934863813 2:97788164-97788186 CAGTTTTCATTCTTCACCACTGG + Intronic
938315234 2:130320934-130320956 ATGTTAGCCTTGATCACCAATGG + Intergenic
939646736 2:144708928-144708950 CTGTTAACCATGTCCTCCACTGG - Intergenic
941610193 2:167652056-167652078 CTGCTTTCCTTGTTAACCCCTGG - Intergenic
943685000 2:190809181-190809203 CTGTTTACCTTGTTCTGCACTGG - Intergenic
944475178 2:200096257-200096279 CAGTTATCCTTGTTTAACAAAGG + Intergenic
946857599 2:223968243-223968265 CTGCTATTCTTGTTAACCCCTGG - Intergenic
948980324 2:241491243-241491265 CTGTTTTCCTTGGTCCCCATTGG + Intronic
1169030387 20:2402323-2402345 CTTGTATCCTTGTTCCCCAGGGG + Intronic
1177686036 21:24438563-24438585 CTGTTTTCCTAGGTCACCACTGG - Intergenic
1183026068 22:35066716-35066738 CTCTTCTCTTTGTTCGCCACTGG + Exonic
949752464 3:7370302-7370324 CTCTTATCCATGTACCCCACAGG + Intronic
950818876 3:15736817-15736839 TTGTTTTCCTTGGTCACCACAGG + Intronic
953473744 3:43188772-43188794 AGGTTCCCCTTGTTCACCACTGG + Intergenic
955564176 3:60226122-60226144 CTCTGGTCCTTCTTCACCACTGG - Intronic
955628823 3:60950334-60950356 CTGTTATCTTTGTATACCATTGG + Intronic
960936259 3:122905002-122905024 ATGTAATCCTTGTTTACCATTGG - Intergenic
961721905 3:128902723-128902745 CTGGTAGCCTGGTTCAGCACTGG - Intronic
962400555 3:135055686-135055708 TTGTCATCCTTGTTCACACCCGG + Intronic
966504042 3:180679307-180679329 TTGTTCTCCTCGTTCGCCACCGG + Exonic
968098246 3:195947367-195947389 CTGGAATCATTCTTCACCACCGG + Intergenic
971012314 4:22451951-22451973 CTGTTATCATCCTTCACAACTGG + Intronic
971218744 4:24685873-24685895 CTGTTTCCCTTGTTGGCCACAGG - Intergenic
971699128 4:29945981-29946003 CTTTTATCCTTTTTCAGCTCTGG - Intergenic
972374200 4:38455701-38455723 CTATTCTCCTTCTTCAGCACGGG - Intergenic
972609522 4:40643941-40643963 CTGTTTCCCTTTTTCCCCACAGG - Intergenic
986138766 5:5009455-5009477 GTTTTATGCTTGTTCTCCACTGG + Intergenic
988054685 5:26078849-26078871 CTCTAGTCCTTGTTCCCCACTGG + Intergenic
992931839 5:81655607-81655629 CTTTACTCCTTGGTCACCACAGG + Intronic
993116013 5:83721442-83721464 CTGTTATCCTTGATCTCCTTTGG - Exonic
995950067 5:117701160-117701182 CTGTTATCCCAGATCACAACTGG + Intergenic
998170129 5:139867930-139867952 TTGTTATCATTGTTCTCCAAGGG - Intronic
1000073460 5:157762878-157762900 CTGTTATTCCTCTACACCACAGG - Intergenic
1000556497 5:162732872-162732894 CTGTTGTCCTTGTTCATTCCTGG + Intergenic
1003580326 6:7334292-7334314 CTACTTTCCTTCTTCACCACTGG - Intronic
1003933480 6:10951741-10951763 CCTTTATCATTGTTTACCACAGG + Intronic
1003962049 6:11217948-11217970 CTCTCATCCTTATTCTCCACTGG + Intronic
1005957575 6:30675084-30675106 CTGTTTTCCTGGGTCACAACTGG + Intergenic
1007197833 6:40078010-40078032 CTGTCATCCTCATTCTCCACAGG + Intergenic
1008844316 6:55943525-55943547 CTGACATTCTTGTGCACCACCGG + Intergenic
1011351798 6:86432316-86432338 CTGTTGTCCTGAATCACCACAGG - Intergenic
1016191272 6:141267903-141267925 CTTTTTTTCTTGTTTACCACTGG - Intergenic
1019133640 6:169894946-169894968 GTGTTGTCCTCGTTCACCAAAGG + Intergenic
1025518371 7:61684911-61684933 ATATTTTCCTTATTCACCACAGG + Intergenic
1025542697 7:62113558-62113580 ATATTTTCCTTATTCACCACAGG + Intergenic
1027257737 7:76441992-76442014 CTGTTATCCTGGTTCTCACCAGG + Exonic
1027281111 7:76610043-76610065 CTGTTATCCTGGTTCTCACCAGG - Exonic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1036086351 8:5617136-5617158 CTGTCCCCCTTGTTGACCACAGG - Intergenic
1037087703 8:14873145-14873167 CTGATAACTATGTTCACCACTGG - Intronic
1042762434 8:72285388-72285410 ATGTTATCATTGTTATCCACAGG - Intergenic
1044704194 8:94992856-94992878 CTGTTATTCTTGTGCATCATCGG - Intronic
1045152950 8:99429733-99429755 CTGTCTTCCTTTTTCAACACTGG + Intronic
1047460140 8:125055716-125055738 CTGTTATCTTTGTTCATTCCAGG - Intronic
1052282715 9:26751608-26751630 CTGTTACCCCTTGTCACCACAGG - Intergenic
1053425908 9:38009772-38009794 CTGTTTTCCTTGCTTACAACTGG - Intronic
1055171248 9:73260768-73260790 CTGTTGTCTTTGTTCATCTCTGG + Intergenic
1055208062 9:73757388-73757410 CTGTCATCTTTGTCCAGCACTGG + Intergenic
1057328193 9:94086223-94086245 CTGTCATTATTGTTCACCACAGG + Intronic
1057434467 9:95026809-95026831 CTGGGACCCTTGTTCATCACTGG - Intronic
1058260864 9:102829541-102829563 CTGATATGCTTGTTCTACACAGG - Intergenic
1059131653 9:111757598-111757620 CTATCATCCTTGTTAAACACTGG + Intronic
1061061660 9:128253678-128253700 CTTTTACCCTAGGTCACCACTGG - Intronic
1061639554 9:131941546-131941568 CTGTTGTCGTTGTTTACCACTGG - Intronic
1186959214 X:14716696-14716718 CTATTATCTTTGCTCACCAGAGG - Intronic
1188448199 X:30279726-30279748 CTGATAGCCTTGCTCAACACAGG - Intergenic
1188790466 X:34403329-34403351 CTGTTACCTTTGCCCACCACTGG - Intergenic
1192522161 X:71812367-71812389 CTGGAATCCTTGTACACTACTGG - Intergenic
1192774725 X:74231435-74231457 CTGCTATGGTTTTTCACCACCGG - Intergenic
1195400407 X:104455179-104455201 CTGTTATCCTTTGACATCACTGG + Intergenic
1200009103 X:153108138-153108160 CTCTTATCTCTGCTCACCACGGG + Intergenic
1200030497 X:153291784-153291806 CTCTTATCTCTGCTCACCACGGG - Intergenic
1200872749 Y:8121178-8121200 CCATTCTCCTTGTTCCCCACTGG - Intergenic
1202368097 Y:24180326-24180348 CTTTTATCCTAGATCACCACTGG + Intergenic
1202502688 Y:25489791-25489813 CTTTTATCCTAGATCACCACTGG - Intergenic