ID: 1068749603

View in Genome Browser
Species Human (GRCh38)
Location 10:60576879-60576901
Sequence GCAGTTGGTAGAATTGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 166}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068749603 Original CRISPR GCAGTTGGTAGAATTGCTTC TGG (reversed) Intronic
904188314 1:28723273-28723295 CCAGTTGGTACCATTGCTTGAGG + Intergenic
906350646 1:45055894-45055916 GGAGGCGGTAGAATTGCTTGAGG + Intronic
908910899 1:69071664-69071686 GGAGTTGCTGGAGTTGCTTCAGG + Intergenic
909760085 1:79275462-79275484 GCTGTTGGTGCAATTGCTTTTGG - Intergenic
913500879 1:119471633-119471655 GCACTTGGAAGATTTGATTCTGG - Intergenic
918352158 1:183668533-183668555 TGAGGTGGTAGAATTGCTTGAGG - Intronic
919253703 1:195095224-195095246 GCTTTTGCCAGAATTGCTTCTGG + Intergenic
923964220 1:239118797-239118819 GTATTTGGTAGCATTTCTTCAGG + Intergenic
924921038 1:248629293-248629315 CGAGTTGGGAGAATTGCTTGAGG + Intergenic
1062805554 10:417190-417212 GCAGATGTCAGAATTGCCTCAGG + Intronic
1063892301 10:10642986-10643008 GCAGTTGGGAGAGTTGCAGCTGG + Intergenic
1064797150 10:19025216-19025238 CAAGTTGGGAGAATTGCTTGAGG - Intergenic
1066571473 10:36777515-36777537 GCAGTTGGGAGAATGGATTGGGG - Intergenic
1066665228 10:37776382-37776404 GCAGGAGGAAGAATTACTTCAGG + Intergenic
1067854820 10:49783274-49783296 TCAGGTGGGAGGATTGCTTCAGG + Intergenic
1068218731 10:54015862-54015884 GCTGTTGTTAAAATTGCTTTTGG - Intronic
1068381156 10:56255263-56255285 GCACTGTGTAGAATTGCTCCTGG + Intergenic
1068749603 10:60576879-60576901 GCAGTTGGTAGAATTGCTTCTGG - Intronic
1072344951 10:94495399-94495421 CCAGGTGGGAGAATTGCTTGAGG - Intronic
1074015395 10:109529138-109529160 GGAGTTGGGAGGATAGCTTCAGG - Intergenic
1075217685 10:120552862-120552884 GCAGTTGATGGAATTGATGCAGG + Intronic
1075502084 10:122984361-122984383 CAAGTTGGAAGAATTGCTTGAGG - Intronic
1081274718 11:41134334-41134356 TGAGGTGGTAGAATTGCTTGAGG - Intronic
1085291334 11:75402033-75402055 GTAGGTGGTAGAAGTGCTTTAGG + Intronic
1087337155 11:96858886-96858908 GCATTTGTTACAATTGCTTTTGG + Intergenic
1088479364 11:110280479-110280501 ACAGTTGGGAGGATTGCTTGAGG - Intronic
1092338716 12:7657162-7657184 GCAGTTGGTTCAAATGATTCTGG - Intronic
1092340929 12:7675395-7675417 GCAGTTGGTTCAAATGATTCTGG - Intergenic
1094152070 12:27295876-27295898 GCAGTGGATATAACTGCTTCAGG + Intronic
1095044194 12:37482005-37482027 ACAGTTGGTAGAATTCATTTGGG + Intergenic
1095065994 12:37775658-37775680 GCAGTTGGTCAGAATGCTTCTGG - Intergenic
1097662052 12:62440823-62440845 GCTGTTGTTATAATTGCTTTTGG + Intergenic
1099343131 12:81464147-81464169 GGAGGTGGGAGAATTGCTTGAGG - Intronic
1099695404 12:86012889-86012911 TGAGTTGGGAGGATTGCTTCAGG + Intronic
1100984312 12:100189936-100189958 GCAGTAGATTGAATTGATTCAGG + Intergenic
1101530014 12:105565178-105565200 CCAGGTGGAAGAATTCCTTCAGG - Intergenic
1102065909 12:109975445-109975467 GCGATTAGGAGAATTGCTTCAGG + Intronic
1103473565 12:121201328-121201350 AGAGCTGGGAGAATTGCTTCAGG + Intergenic
1103889038 12:124224762-124224784 GCTTGTGGTAGAATTGCTGCTGG - Intronic
1105741539 13:23329405-23329427 CCAGTTGTTAGTATTGTTTCTGG - Exonic
1109591836 13:64494538-64494560 GCAGTTGTTAGTATTAGTTCTGG - Intergenic
1109847941 13:68021870-68021892 ACAGGTGGTAGCAGTGCTTCAGG - Intergenic
1110738471 13:78966300-78966322 TCAGTTGGTAGATTTGCTGGTGG - Intergenic
1110865984 13:80397010-80397032 TGAGGTGGGAGAATTGCTTCAGG + Intergenic
1112030262 13:95450105-95450127 CAAGGTGGGAGAATTGCTTCAGG - Intronic
1115077291 14:29407264-29407286 GCTTTTGTTACAATTGCTTCTGG + Intergenic
1118386242 14:65257785-65257807 GCAGTTGGGGGACTTGCCTCTGG - Intergenic
1119536454 14:75406719-75406741 TGAGGTGGGAGAATTGCTTCAGG - Intergenic
1121430682 14:93885169-93885191 GCTGTTGTTAAAATTGCGTCAGG - Intergenic
1122399676 14:101459127-101459149 GCAGTGGCTGTAATTGCTTCGGG + Intergenic
1125012921 15:34899601-34899623 GAAGTTGGGAGGATTGCTTGAGG - Intronic
1127601640 15:60543574-60543596 TGAGGTGGTAGGATTGCTTCAGG - Intronic
1127775794 15:62263554-62263576 GCTGTTGGTAGAGTTACTGCAGG + Intergenic
1129748032 15:78038582-78038604 GCAGTCGATTGAATTGATTCAGG + Intronic
1130315920 15:82796432-82796454 GAAGTTGGCAGCATTGCTGCGGG + Intronic
1131221882 15:90591350-90591372 GGAGGTGGGAGAATTGCTTGAGG - Intronic
1132375998 15:101328564-101328586 GCAGCTGGGAGCACTGCTTCAGG - Intronic
1134065124 16:11223598-11223620 TGAGGTGGAAGAATTGCTTCAGG - Intergenic
1137637936 16:50003357-50003379 TGAGGTGGTAGAATTGCTTGAGG - Intergenic
1138220262 16:55244367-55244389 GCAGTGGGTAGAACCGCTTAGGG + Intergenic
1140155781 16:72425627-72425649 GCAGTTGCTAGCTTTGCTGCGGG + Intergenic
1142959485 17:3543519-3543541 GGAGTTGGTAGAGTTGCTGGTGG - Exonic
1147056494 17:37839155-37839177 GCAGCTGGTAGGATTGCACCTGG - Intergenic
1147199986 17:38794538-38794560 CTAGTTGGGAGGATTGCTTCAGG + Intronic
1148971641 17:51488514-51488536 GCAATTTGTAAAATGGCTTCAGG - Intergenic
1149394282 17:56223228-56223250 GCTGTTGATAGAATTACTTCTGG + Intronic
1150246023 17:63676027-63676049 GGAGTTGGCAGAACTGCTCCAGG - Intronic
1151065546 17:71145302-71145324 CAAGGTGGGAGAATTGCTTCAGG - Intergenic
1155235804 18:23817477-23817499 CCAGTTGGGACAATTGCTTGAGG + Intronic
1155571692 18:27201698-27201720 GCTGTTTGTAGAAATGCTACAGG + Intergenic
1156922521 18:42540172-42540194 TAAATTGGTACAATTGCTTCAGG + Intergenic
1157849838 18:51038054-51038076 GGAGGTGGGAGAATTGCTTTTGG + Intronic
1160454123 18:78985660-78985682 GCTGATGGTAGCCTTGCTTCTGG + Intronic
925225272 2:2178678-2178700 ACACTTGGTAGAATGGCTTTTGG + Intronic
930461696 2:51687552-51687574 CCAGATGGTAGGATTGCTTAAGG + Intergenic
932332985 2:70909432-70909454 GCAGGTGGGAGGATTGCTTGAGG - Intronic
936096218 2:109532171-109532193 TCAGGGGCTAGAATTGCTTCTGG + Intergenic
936168219 2:110142582-110142604 GGAGGTGGTAGAATCGCTTGAGG - Intronic
937165296 2:119808654-119808676 GGAGGTGGGAGGATTGCTTCAGG - Intronic
937291067 2:120782286-120782308 GCAGGTGGTAGACTTCCTTCAGG + Intronic
937745076 2:125402933-125402955 GCATGTGGTTGAAATGCTTCAGG + Intergenic
941049891 2:160721119-160721141 GCAGATGGTAGAAGTGGTTAAGG - Intergenic
944100267 2:196018024-196018046 GCAGTTGTTTGATTTGTTTCAGG + Intronic
946108842 2:217396403-217396425 GAAGTTGGAGGAACTGCTTCAGG + Intronic
1169433789 20:5565459-5565481 CAAGTTGGGAGAATTGCTTGAGG - Intronic
1170053058 20:12168187-12168209 GCTCTTGTTAGAATTGCTTTTGG + Intergenic
1172457319 20:35087632-35087654 GCAGTTGATAGAATCAATTCTGG - Intronic
1178798639 21:35770310-35770332 GGAGTTGGGAGGATTGCTTGAGG + Intronic
1181542407 22:23580385-23580407 GCAGTTGGCAGATGTGCCTCTGG - Intergenic
1182116578 22:27759983-27760005 GCAGGTGGGAGGATTGCTTAAGG + Intronic
1183188664 22:36307323-36307345 GCAATTGGTTTAATTGCTGCTGG - Intronic
1203310123 22_KI270736v1_random:136935-136957 GCAGTTGATGGAATTGATTTGGG + Intergenic
952870351 3:37894337-37894359 GGAGGTGGGAGAATTGCTTGAGG - Intronic
954437002 3:50501592-50501614 GCAGTTGGTCAGATGGCTTCTGG - Intronic
955474331 3:59320290-59320312 ACAGTTTGTAGAACTGCCTCTGG + Intergenic
955957903 3:64309397-64309419 GCAAATGGTAGATTAGCTTCAGG - Intronic
956651631 3:71509647-71509669 TCAGATGGGAGAATTGCTTGAGG + Intronic
956734486 3:72227754-72227776 GCAGAGTGTAGAATTACTTCTGG + Intergenic
960947090 3:122974232-122974254 GCAGTTCCCAGAAATGCTTCTGG - Intronic
961247879 3:125472608-125472630 GCACTTGGTACAGCTGCTTCTGG + Intronic
961832283 3:129629408-129629430 CCAGTTAGAAGAATTGCTTTAGG + Intergenic
967205124 3:187112653-187112675 GGAGGTGGGAGAATTGCTTGAGG - Intergenic
970239683 4:13995408-13995430 CCAGTGGGTAGTCTTGCTTCTGG - Intergenic
970268605 4:14318262-14318284 GCAGGTGGAAGAATTCCTTAGGG - Intergenic
972280713 4:37599512-37599534 GCTTTTGTTAGAATTGCTTAAGG - Intronic
972754315 4:42029237-42029259 GCAGTTGGAAGAAATTCTTCTGG + Intronic
973793492 4:54399984-54400006 CGAGTTGGGAGGATTGCTTCAGG + Intergenic
975387360 4:73773352-73773374 TCAGGTGGGAGAATTGCTTGAGG - Intergenic
977028531 4:91852394-91852416 GCATATGGTAGATTTTCTTCTGG - Intergenic
977423840 4:96839775-96839797 GCACAGGGTAGAAATGCTTCAGG + Intergenic
981101576 4:140834715-140834737 GTAGTTGGGAGAATTTTTTCTGG + Intergenic
982201723 4:152968076-152968098 GCAGATGGAAGATTTTCTTCAGG + Exonic
983228280 4:165105725-165105747 GCACTTGGGAGGATTGCTTGAGG - Intronic
984160309 4:176244678-176244700 GGAGGTGGGAGAATTGCTTGGGG + Intronic
985127062 4:186705174-186705196 GCAGGTGGGAGGATTGCTTGAGG - Intronic
986333148 5:6732996-6733018 GCAGTTGGAAGCTCTGCTTCCGG + Intronic
988603396 5:32659905-32659927 GCATTTGTTGCAATTGCTTCTGG + Intergenic
988619450 5:32808088-32808110 GCTTTTGTTGGAATTGCTTCTGG + Intergenic
988885081 5:35547856-35547878 GCAGTTGTGAGAATTGCATTTGG + Intergenic
996223895 5:120965811-120965833 GCATTTGGGAGGATTGCTTGAGG + Intergenic
998246104 5:140506831-140506853 GTAGGTGGTAGACTTGCTGCTGG + Exonic
1000883570 5:166724416-166724438 GCGGTTGAAAGAATTGATTCTGG - Intergenic
1001690301 5:173628062-173628084 GCAGTGGGTTGAAATGCTGCTGG + Intergenic
1003687269 6:8316601-8316623 CAAGTTGGGAGAATTGCTTGAGG + Intergenic
1003829843 6:9995916-9995938 GCAATTGGGAGAATTGCTCTAGG - Intronic
1003899584 6:10641618-10641640 GCAGTTGAAAGAAATGCCTCTGG - Intergenic
1006956863 6:37881497-37881519 GCAGGAGGTAGGATTGCTGCTGG + Intronic
1011889319 6:92137455-92137477 GCTGGTGATAAAATTGCTTCTGG - Intergenic
1015671012 6:135689616-135689638 AAAGGTGGTAGAATTGCTACAGG - Intergenic
1016063145 6:139651053-139651075 GCAGACGTTAGAATTGCTGCAGG + Intergenic
1016091354 6:139983161-139983183 ACAGATGGTAAAATGGCTTCAGG - Intergenic
1016820553 6:148342737-148342759 GCAGTGGGTTTAATTGCTTCTGG + Exonic
1023363234 7:39437184-39437206 GGAGCTGGTATCATTGCTTCTGG - Intronic
1025290120 7:57711551-57711573 ACAGTTGGTAGAATTCATTTGGG + Intergenic
1026083517 7:67242945-67242967 TAAGATGGTAGAATTGCTTGAGG - Intergenic
1029230448 7:99063520-99063542 GAAGTTGGGAGGATTGCTTGAGG - Intronic
1032258943 7:130319146-130319168 GCAGTAGCTTGTATTGCTTCAGG + Intronic
1032648218 7:133849186-133849208 GGAGGTGGTAGGATTGCTTGAGG + Intronic
1033324473 7:140366150-140366172 GGAGTGGGGAGAATTGCTTGAGG - Intronic
1033478812 7:141717905-141717927 GCAGTTGGTAGAAGGTCTTGAGG + Intronic
1036437970 8:8753123-8753145 GCTGTTTTTAGAATTCCTTCTGG + Intergenic
1038350573 8:26772472-26772494 ACAGTTGGTAGAATGGCTTTGGG + Intronic
1041669001 8:60474577-60474599 GCACTTAATAGAATTGCTTTTGG + Intergenic
1041782054 8:61587801-61587823 GCAGTTGGGAAAATTGCCTCAGG - Intronic
1042253161 8:66776110-66776132 GCTGTTGCTAGAAATGCTTGGGG + Intronic
1042316118 8:67427737-67427759 GTAGTAGTTAGAATTGCTTAAGG + Intronic
1042911377 8:73830715-73830737 GAGGTTGGGAGAATTGCTTGAGG - Intronic
1043373024 8:79614035-79614057 GCAGTTGGAAGAACAGTTTCAGG - Intronic
1044796708 8:95908367-95908389 GCAGTGGGTAGAATTGGATGTGG - Intergenic
1045713734 8:105017118-105017140 CCACTTGGTAGAAATGCTGCAGG - Intronic
1050184753 9:2961074-2961096 ATAGTTGGTAGATTTGCTTTTGG + Intergenic
1050525308 9:6541480-6541502 GCAGTTCGTAGACTGTCTTCAGG - Intronic
1052350487 9:27453775-27453797 GCAGTTGCTAGTAAGGCTTCTGG + Intronic
1055366407 9:75549096-75549118 GAAGGTGGAAGGATTGCTTCAGG - Intergenic
1055392705 9:75840362-75840384 ACAGTATGTAGAATTGCTTCAGG + Intergenic
1057639623 9:96805433-96805455 GTATTTGGTAGTATTGCTTCTGG - Intergenic
1058322808 9:103655923-103655945 GTATTTGGTAGAATTTCTTGTGG - Intergenic
1058768195 9:108203867-108203889 GTAGGTGATAGATTTGCTTCTGG - Intergenic
1059461806 9:114435659-114435681 GCAGGTGGTAGACTGGATTCTGG - Intronic
1059846142 9:118278972-118278994 GCAGATGGTATACTAGCTTCAGG - Intergenic
1062004613 9:134232992-134233014 GCAGTTGGCAGACTAGCTTCGGG + Intergenic
1187506076 X:19879586-19879608 GAAGTTGTTAAACTTGCTTCTGG - Intronic
1190801987 X:53797864-53797886 GCAGTGGGAAGAAGTGCTACAGG + Intergenic
1192329679 X:70165209-70165231 GCAGTTGGTTTAATTTCTTTTGG + Intronic
1192474958 X:71432584-71432606 GCAGGTGATAAAATTGATTCAGG + Intronic
1192634401 X:72804166-72804188 GCAGTCTGTAGAATTACCTCAGG + Intronic
1192647309 X:72916635-72916657 GCAGTCTGTAGAATTACCTCAGG - Intronic
1194465559 X:94230712-94230734 GCTGTTGTTACAATTGCTTTTGG + Intergenic
1195043500 X:101035113-101035135 GAAGGTGGCAGAATTGCTTGAGG + Intronic
1197428763 X:126332071-126332093 GCATTTGCTAGATTTTCTTCAGG + Intergenic
1197763080 X:130041136-130041158 TCAGGTAGGAGAATTGCTTCCGG + Intronic
1198246212 X:134834537-134834559 GCTTTTGTTAGAATTGCTTTTGG + Intronic
1200270043 X:154674202-154674224 TGAGGTGGAAGAATTGCTTCAGG - Intergenic
1200687417 Y:6268764-6268786 GGAGTTGGTAGGATGGCTGCTGG - Intergenic
1201047857 Y:9905946-9905968 GGAGTTGGTAGGATGGCTGCTGG + Intergenic
1201501001 Y:14642586-14642608 TCAGGTGGGAGAATTGCTTGAGG + Intronic