ID: 1068752441

View in Genome Browser
Species Human (GRCh38)
Location 10:60610614-60610636
Sequence GACAGTGATCTCTTCAAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068752441_1068752442 0 Left 1068752441 10:60610614-60610636 CCAAACTTGAAGAGATCACTGTC 0: 1
1: 0
2: 0
3: 14
4: 130
Right 1068752442 10:60610637-60610659 ATATTTTTAAGTCATTTTCCAGG No data
1068752441_1068752443 1 Left 1068752441 10:60610614-60610636 CCAAACTTGAAGAGATCACTGTC 0: 1
1: 0
2: 0
3: 14
4: 130
Right 1068752443 10:60610638-60610660 TATTTTTAAGTCATTTTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068752441 Original CRISPR GACAGTGATCTCTTCAAGTT TGG (reversed) Intronic
904287972 1:29465397-29465419 GACAGTGATCCCTGAAAGATGGG - Intergenic
908459775 1:64338216-64338238 GAGAGTCATCTTTTCAACTTGGG - Intergenic
908503205 1:64765666-64765688 GTCAGTGTTCTCGTCAAGTTTGG + Intronic
909163400 1:72183681-72183703 AATATTGAGCTCTTCAAGTTAGG - Intronic
909321182 1:74287313-74287335 GACAGAAAACTTTTCAAGTTTGG + Intronic
910262579 1:85306477-85306499 GACAGTGAGCTCCTAGAGTTAGG - Intergenic
911004354 1:93202778-93202800 GACAGTGAGCTCTTTAGGATAGG - Intronic
911770416 1:101733718-101733740 GACAGTGGTCTCATGAAGGTTGG + Intergenic
918440840 1:184565798-184565820 AACAGTGATCTGTATAAGTTTGG - Intronic
924001381 1:239556673-239556695 GACAGGGGCCTCCTCAAGTTAGG + Intronic
924819794 1:247478285-247478307 GACAGTTGTCTCTCCAAGCTGGG - Intergenic
1068752441 10:60610614-60610636 GACAGTGATCTCTTCAAGTTTGG - Intronic
1068789769 10:61015110-61015132 GGCTGTCATCTCTTCAAGCTTGG - Intergenic
1071784645 10:88885183-88885205 GACAGGGATCCATACAAGTTAGG - Intronic
1074984447 10:118644471-118644493 GAAAGTGAGATCTTCCAGTTAGG - Intergenic
1076225037 10:128767408-128767430 GGCAGTGATCTCTTGAAGAAAGG - Intergenic
1077902880 11:6504110-6504132 CACACTGATCTCTTGAACTTAGG + Intronic
1079119047 11:17665766-17665788 GACAGTGTTCTTTTAAACTTAGG - Intergenic
1081285900 11:41269817-41269839 CACAGTAATCTTTTAAAGTTTGG - Intronic
1085675804 11:78516849-78516871 GACTGTGAGCTTTTCAATTTAGG - Intronic
1086482560 11:87258550-87258572 GAAAGTGAGATCTTCCAGTTAGG + Intronic
1086990778 11:93301997-93302019 GTTATTGATCTATTCAAGTTTGG - Intergenic
1088761930 11:112939139-112939161 GACAGTGATCTCTTAGAAATAGG - Intergenic
1089180141 11:116577964-116577986 GGCATTGAGCTCTGCAAGTTAGG + Intergenic
1090188426 11:124752762-124752784 AACAGAGATCTCTTCCAGATGGG + Intronic
1090712110 11:129396461-129396483 TGCAGTGATCTCTTCCAGCTTGG + Intronic
1096678225 12:53237222-53237244 GACAGTGATCTCTTTATTTCTGG - Intergenic
1097704757 12:62856384-62856406 GATAGTGATCTCTGAAAGATGGG - Intronic
1099726350 12:86432927-86432949 GAAAGTGATTTCTTCCATTTGGG - Intronic
1100384537 12:94093292-94093314 GACAGTGATGACTTGAACTTGGG - Intergenic
1100478280 12:94953830-94953852 GACAGATATCTCTCCAAGTTGGG + Intronic
1100704418 12:97184766-97184788 GACAGGGATTTCTCCAAGCTTGG + Intergenic
1100979667 12:100154545-100154567 GACAGTGTTCTCTTGTAGTTGGG - Intergenic
1106440995 13:29770030-29770052 GACAGTTTTCTCTTCAATATAGG - Intronic
1107804049 13:44137812-44137834 CAGAGAAATCTCTTCAAGTTGGG + Intergenic
1108098166 13:46926570-46926592 GAAAGTGATCTCTTCAGTTTGGG + Intergenic
1108448601 13:50536306-50536328 AACAGTCATCTTTTCAAATTTGG + Intronic
1108931001 13:55819648-55819670 TACAGAGATCTCATAAAGTTGGG - Intergenic
1116930521 14:50686595-50686617 GATATTGATATCTTCAGGTTTGG + Intergenic
1120466610 14:84865931-84865953 GACATTGATCTCTTATTGTTTGG + Intergenic
1121992360 14:98571884-98571906 GACAGGGATGTCTTCAAGCCAGG - Intergenic
1123157973 14:106248246-106248268 TACAGAGATCTGTTTAAGTTTGG - Intergenic
1124836137 15:33197756-33197778 TAAAGTGATCTCTTCAGGTATGG - Intergenic
1125152548 15:36549392-36549414 TAGAGTGATCTTTTCAAGTAGGG + Intergenic
1125447686 15:39775655-39775677 GACAGTGTTCTCATGAAATTTGG + Intronic
1127657099 15:61065927-61065949 GTCAGTGTTCCCTTCAAGGTTGG + Intronic
1129053337 15:72800742-72800764 TACAGAGATCTCTCCCAGTTGGG + Intergenic
1130347526 15:83062230-83062252 AACAGTGATCTCTCCAATATTGG - Intronic
1130456746 15:84118245-84118267 GTCAGTGTTTTCATCAAGTTAGG - Intergenic
1136908201 16:34122007-34122029 GACAGTGATCTCCTCCATTCAGG + Intergenic
1151415036 17:73956651-73956673 AACAGGGGTCTCTCCAAGTTAGG + Intergenic
1152329996 17:79667215-79667237 GACAGTGTCCTCTCCAAGATGGG - Intergenic
1158583561 18:58707935-58707957 GAGAGAGATCTCTTGCAGTTTGG - Intronic
1162188917 19:8929444-8929466 CACAGTGATGTCTTGTAGTTAGG + Intronic
1162396962 19:10422843-10422865 GACAGTGACCTGTGCCAGTTTGG - Intronic
925574973 2:5350864-5350886 GACAGTGTACTCTTCAACTTGGG + Intergenic
925693567 2:6550177-6550199 GACAGTGTGCTCTTGAACTTAGG - Intergenic
928660609 2:33498599-33498621 GATGGTGAGGTCTTCAAGTTGGG - Intronic
929126011 2:38523373-38523395 GACAGTGATGTCCTCAAATTGGG + Intergenic
935386146 2:102501844-102501866 GACTCTGATCTCTCCAAGATGGG - Intronic
936806945 2:116345617-116345639 GACAGTGATACCTGCAAGGTGGG - Intergenic
944912162 2:204321690-204321712 GACAATGATCTCTTCCATGTGGG - Intergenic
945356489 2:208845528-208845550 GACAGTGATTTCTGGAAGATGGG + Intronic
945562290 2:211353895-211353917 CACAGTGATCCTTTCAAGTCTGG - Intergenic
947198646 2:227595429-227595451 GACAATGCTCTCTGCAAGTGTGG + Intergenic
947209015 2:227689229-227689251 GATATTGATCTCTTTAGGTTTGG - Intronic
1172039946 20:32036753-32036775 GACAGTGAACTCCCCAAGGTAGG - Intergenic
1172103205 20:32498107-32498129 GACAATGAGCTGTTCAGGTTCGG + Intronic
1172428120 20:34869932-34869954 GACAGTGATCATTCCAAGGTTGG - Intronic
1174779286 20:53373586-53373608 GACGGTGATGACTTAAAGTTGGG + Intronic
1179299540 21:40094248-40094270 GACAGTGATCTCTGAAAGATGGG + Intronic
1183575256 22:38684118-38684140 GAAAGTGAGATCTTCCAGTTAGG - Exonic
1184560326 22:45259452-45259474 GAAAGTGACATGTTCAAGTTTGG - Intergenic
1185391901 22:50566546-50566568 GCCAGTGATCCCTTAAAATTAGG + Intergenic
949725844 3:7043467-7043489 GACAGTGAACTCTAAAAGTCAGG - Intronic
951606002 3:24435547-24435569 GAGAGGTATCTCATCAAGTTAGG - Intronic
952300036 3:32096902-32096924 GACAGTGTTTTCTAGAAGTTTGG - Intergenic
959786176 3:110301181-110301203 GTCAATGATCTCTTTAACTTGGG + Intergenic
959786407 3:110303910-110303932 GTCAATGATCTCTTTAACTTGGG + Intergenic
960809335 3:121613148-121613170 AACAGTGAGCTCTTCAGGATAGG + Intronic
962975047 3:140438955-140438977 CACATAGTTCTCTTCAAGTTTGG + Intronic
966347409 3:178994608-178994630 AGCAGTGAACTCTTCAACTTTGG + Intergenic
970301277 4:14683867-14683889 CACAGTGATCTGTTCAAGGATGG + Intergenic
970526800 4:16940822-16940844 GTCAGTGATCTACTCATGTTAGG - Intergenic
971940763 4:33212419-33212441 GGCAGGGATCACTTGAAGTTAGG + Intergenic
972247830 4:37264136-37264158 GACAGTTATCTGTTCAAATTGGG - Intronic
973559928 4:52124999-52125021 GACAGTGATCTCTATCAGATGGG - Intergenic
974255327 4:59445913-59445935 GACAGTGATCCCTGAAAGATGGG + Intergenic
975675714 4:76825301-76825323 GACACTGGTCTCTTCAACCTGGG - Intergenic
975980248 4:80149233-80149255 GACTGTGATCTCTGAAAGCTGGG + Intergenic
979908922 4:126335123-126335145 GACAGTGGTCTTTACAAGTGTGG - Intergenic
980188318 4:129490846-129490868 GCCAGGGCTCTCTTCAAGTAAGG + Intergenic
981045388 4:140260014-140260036 GAGAGTGATCATTTCAAGCTGGG - Intronic
981171183 4:141625054-141625076 GAGAGTCATCTATTCAAGTTGGG - Intergenic
983434989 4:167701846-167701868 GACAGATATCTCTTCTAATTTGG + Intergenic
988938460 5:36116035-36116057 TAGAGAGATGTCTTCAAGTTGGG - Intronic
990339911 5:54812159-54812181 GACATGTATCTCTTCCAGTTAGG - Intergenic
992038180 5:72802447-72802469 GATAGTTTTCTCTTGAAGTTGGG - Intergenic
994864419 5:105247508-105247530 GACAGAGATCTCTTCCAGTACGG + Intergenic
995091037 5:108177650-108177672 GACAGTGAGCCCTTCATGGTAGG + Intronic
997732070 5:136188924-136188946 GACAGTCATCTCTCTTAGTTTGG + Intergenic
998182649 5:139956186-139956208 GACAGTGATTCCTACAAGCTAGG - Intronic
998907825 5:146925595-146925617 GACAATGATGTGTTCAAGTGTGG + Intronic
1007382372 6:41499127-41499149 GACAGAGATCTAATCAAGTCTGG - Intergenic
1009439276 6:63657031-63657053 GAGTGTGTTCTCTTCAAGTCTGG + Intronic
1010837180 6:80603240-80603262 GTTATTGATCTCTTCAGGTTTGG + Intergenic
1011661317 6:89596485-89596507 GAAAATGATCTATTCAAGTTGGG + Intronic
1012318078 6:97805454-97805476 GAAAGTAATCTGTTCAGGTTTGG + Intergenic
1014665003 6:124227035-124227057 GAAAGAAATTTCTTCAAGTTTGG + Intronic
1014955463 6:127609847-127609869 GACAGTGATATCTCTAGGTTTGG + Intergenic
1015814937 6:137199151-137199173 GACTCTGAATTCTTCAAGTTTGG + Intronic
1017224302 6:152002240-152002262 GACAGTGTTGTCATCAATTTTGG + Intronic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1024890930 7:54202477-54202499 GAAATGGATCTCTTCAAATTAGG + Intergenic
1025980594 7:66402087-66402109 GACTGTGCTCTCTCCAAGTGGGG - Intronic
1027524114 7:79245490-79245512 GGCAGTACTCTCTACAAGTTCGG + Intronic
1028758967 7:94473364-94473386 CACAGTGATCTCCCAAAGTTTGG - Intergenic
1030157642 7:106471671-106471693 GACAGTGATCTCTGAAAGAAGGG + Intergenic
1033537644 7:142327082-142327104 AACAGGGATCTCTTTAAGTGTGG + Intergenic
1034017315 7:147601052-147601074 TACAGTGCTCTCTCCAATTTTGG - Intronic
1035489415 7:159259848-159259870 AACAGAGACCTCTTCAACTTTGG - Intergenic
1037180940 8:16005090-16005112 GACAGTGATCTCCTCTGCTTTGG + Intergenic
1039507861 8:38065053-38065075 GGCAGTGATCACTTGAAGCTGGG - Intergenic
1042062724 8:64838581-64838603 CAAAGTGACCTCTCCAAGTTTGG + Intergenic
1042362957 8:67903232-67903254 GACAGTGAGCTCTGCTTGTTGGG - Intergenic
1042471614 8:69196292-69196314 GACAGTGATGTCATAAAGTTAGG + Intergenic
1042824492 8:72966350-72966372 CACAGTGATTTGTTCAGGTTTGG - Intergenic
1044572028 8:93730752-93730774 GAAAGTGGTATCTTCTAGTTGGG - Exonic
1047594735 8:126366658-126366680 GACAGTGCTCTTTTCAAACTTGG - Intergenic
1048742837 8:137581066-137581088 AAAAGTGATCTCTTCAACTCTGG - Intergenic
1048954825 8:139527033-139527055 GATGGTGATCCCTTCAAGGTAGG + Intergenic
1058287619 9:103199111-103199133 GGCAGTCATCACTTCAATTTGGG - Intergenic
1060086824 9:120710844-120710866 TACAGTGATCTGATCAAGTATGG - Intronic
1061446963 9:130644395-130644417 GAAAGTCATCTGTCCAAGTTGGG - Intergenic
1061614397 9:131770258-131770280 GAGACAGACCTCTTCAAGTTTGG - Intergenic
1061927923 9:133815210-133815232 GACAGTTCTGTCTTCAAGATGGG - Intronic
1189086043 X:38025618-38025640 GAGAGAGATCTGTTTAAGTTAGG + Intronic
1189283707 X:39837188-39837210 GACATTGTTCTCTTTCAGTTTGG + Intergenic
1190306384 X:49084976-49084998 GACAGTGATCCCTGAAAGATGGG + Intronic
1194548355 X:95266912-95266934 GACAGTGATCTGAGAAAGTTAGG + Intergenic
1196466694 X:115979157-115979179 GACACTGAGCTCTTCAAGTCTGG - Intergenic
1198153833 X:133937630-133937652 CACAGTGATCTCTGGATGTTAGG + Intronic
1198389697 X:136161824-136161846 AACAGTGATCTCTTCAAGGCCGG + Intronic
1198589307 X:138159199-138159221 GCCAGTGATGGCTGCAAGTTAGG - Intergenic