ID: 1068753411

View in Genome Browser
Species Human (GRCh38)
Location 10:60623054-60623076
Sequence GTACAGACTCCTTAAAATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 97}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068753411_1068753415 16 Left 1068753411 10:60623054-60623076 CCACCATTTTAAGGAGTCTGTAC 0: 1
1: 0
2: 1
3: 9
4: 97
Right 1068753415 10:60623093-60623115 GTATTGGGTCTTCCCCCAGAAGG No data
1068753411_1068753414 1 Left 1068753411 10:60623054-60623076 CCACCATTTTAAGGAGTCTGTAC 0: 1
1: 0
2: 1
3: 9
4: 97
Right 1068753414 10:60623078-60623100 TGTGACAGTAAACATGTATTGGG No data
1068753411_1068753413 0 Left 1068753411 10:60623054-60623076 CCACCATTTTAAGGAGTCTGTAC 0: 1
1: 0
2: 1
3: 9
4: 97
Right 1068753413 10:60623077-60623099 TTGTGACAGTAAACATGTATTGG No data
1068753411_1068753416 20 Left 1068753411 10:60623054-60623076 CCACCATTTTAAGGAGTCTGTAC 0: 1
1: 0
2: 1
3: 9
4: 97
Right 1068753416 10:60623097-60623119 TGGGTCTTCCCCCAGAAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068753411 Original CRISPR GTACAGACTCCTTAAAATGG TGG (reversed) Intronic
900040029 1:452645-452667 GTACTGAGTACTTAAAAGGGTGG - Intergenic
900061461 1:687621-687643 GTACTGAGTACTTAAAAGGGTGG - Intergenic
901301587 1:8203479-8203501 GGACAGATTCCTGAAACTGGAGG - Intergenic
906281596 1:44558195-44558217 GTACAGACTCAATTAAATGTGGG - Intronic
908015462 1:59828492-59828514 GTAGAAACTCATTAAAATGTTGG + Intronic
908140961 1:61184234-61184256 TCACTGGCTCCTTAAAATGGCGG - Intronic
910008879 1:82435908-82435930 GAACAAACTCCCGAAAATGGAGG - Intergenic
910336975 1:86144663-86144685 CTACAAATTCCTTAAAATTGAGG - Intronic
910485973 1:87714050-87714072 GTACCTAATCTTTAAAATGGGGG + Intergenic
913176586 1:116278313-116278335 CCTCAGACTCCTCAAAATGGTGG - Intergenic
918871557 1:189981713-189981735 GGAGAGACTCCTTAAGATTGGGG - Intergenic
924936877 1:248779277-248779299 GTACAGATACCTGAAAATGTGGG - Intergenic
1063839223 10:10050907-10050929 GTACAGAGTAGTTAGAATGGGGG - Intergenic
1065270610 10:24029610-24029632 GTAAATCCTTCTTAAAATGGGGG - Intronic
1066514010 10:36135137-36135159 GTACAGACACCATAAAATTGGGG - Intergenic
1068753411 10:60623054-60623076 GTACAGACTCCTTAAAATGGTGG - Intronic
1069259273 10:66373667-66373689 GTTCAGACTGCTTAAAGGGGAGG + Intronic
1074959759 10:118432554-118432576 GGAAAGTCTCTTTAAAATGGGGG - Intergenic
1075285421 10:121181162-121181184 GAAAAAGCTCCTTAAAATGGAGG - Intergenic
1080811790 11:35711770-35711792 GTACAGCCTCCTATAAATTGTGG + Intronic
1085365731 11:75941875-75941897 GTACAGAATCCTGGAAAAGGAGG + Intronic
1089413513 11:118267127-118267149 GTCCACACTCCTTAGGATGGTGG - Intergenic
1091349351 11:134880665-134880687 GTACAGAGTCCTTCAAAAAGTGG + Intergenic
1091851824 12:3705747-3705769 GAACAGACCCCTTAAACTGTGGG + Intronic
1101274035 12:103179606-103179628 GTACAGATGCTTTAAAATGGTGG - Intergenic
1101946657 12:109142465-109142487 GTAAAGACCCCTCAAAATGGTGG - Intronic
1104516355 12:129430836-129430858 TTATTCACTCCTTAAAATGGGGG + Intronic
1106326935 13:28700847-28700869 ATACAAAATCCTTAAAAGGGAGG - Exonic
1107285091 13:38781628-38781650 TCACAGATTTCTTAAAATGGGGG + Intronic
1109219100 13:59623352-59623374 GGACTGAATCCTTAAAATGTTGG + Intergenic
1110706628 13:78606168-78606190 CTACATTCTCCTTAAAAAGGAGG + Intergenic
1115421740 14:33202973-33202995 GAACAGACACCATAAAATTGGGG - Intronic
1121220604 14:92282230-92282252 GTTCAGACTCTTTAAGATGTAGG + Intergenic
1122782185 14:104148473-104148495 GTTCAGATTCCTGAAATTGGGGG + Intronic
1124437693 15:29664651-29664673 GGGCAGACTCCCTAAAATGTGGG + Intergenic
1125373027 15:38999080-38999102 GTAAGAACTCCTAAAAATGGGGG + Intergenic
1132441876 15:101874973-101874995 GTACTGAGTACTTAAAAGGGTGG + Intergenic
1133001904 16:2856074-2856096 GTACATACTCCTTGAAACAGTGG + Exonic
1133655748 16:7862179-7862201 TCTCAGACTCCTTAAAATGTGGG + Intergenic
1135894194 16:26383673-26383695 GATCAGCCTCCTTAGAATGGTGG + Intergenic
1140861412 16:79021795-79021817 GTGCAGACTCCTTAATCTGAGGG - Intronic
1141785508 16:86197887-86197909 GTCCAAACTCCTTTAAATGGAGG + Intergenic
1144374889 17:14629304-14629326 GTAAAGTCTTTTTAAAATGGAGG + Intergenic
1144439713 17:15270764-15270786 TCACAGACTCCTTATGATGGAGG - Intergenic
1147690517 17:42312160-42312182 GCACAGATTCCTTAAAAAGCAGG + Intergenic
1147777339 17:42911620-42911642 GCACAGACTCTTTCAGATGGAGG + Exonic
1148757050 17:49978710-49978732 GTGCAGATTGCTTAAAAAGGGGG + Intergenic
1150869008 17:68884121-68884143 GTACAGAGTCCTTAAAATTTGGG + Intronic
1153377337 18:4395560-4395582 GTAAAGATTCATTAACATGGAGG + Intronic
1156838460 18:41583691-41583713 GGAAAGACTTTTTAAAATGGTGG - Intergenic
1157254852 18:46129899-46129921 GTCCAGGCTTCTTTAAATGGTGG - Intergenic
1158892195 18:61883233-61883255 GTAAAGACTTATTGAAATGGTGG - Intronic
1160643056 19:158179-158201 GTACTGAGTACTTAAAAGGGTGG - Intergenic
1166398768 19:42462437-42462459 GTCCAGACTCCTTAAGCTGGTGG - Intergenic
925801086 2:7600929-7600951 GTACTGAATCCTTAGAATGTTGG + Intergenic
928054333 2:28036258-28036280 GTACAGAATACTTGAAATGTAGG - Intronic
928679201 2:33681666-33681688 GTAAACACTTATTAAAATGGTGG + Intergenic
931787634 2:65634595-65634617 GTAGAGACTCATTTAAATCGTGG - Intergenic
936489254 2:112956464-112956486 GTACAGACTCCTTGGGAAGGTGG - Intergenic
937855168 2:126667016-126667038 GAACAGAGTCCTAAAAATAGTGG - Intronic
940433626 2:153624320-153624342 GTAAAGACCTCTTACAATGGAGG - Intergenic
941307317 2:163886483-163886505 GTACTTAATCCCTAAAATGGAGG - Intergenic
942224234 2:173801219-173801241 GAACAGACGCCTTCCAATGGAGG - Intergenic
1172789297 20:37491471-37491493 GTCCAAACTCCTTGACATGGGGG + Intergenic
1178922816 21:36750111-36750133 GTGCAGACTCTTCAAGATGGAGG - Intergenic
1180059797 21:45378970-45378992 GAACAGAGTCCCTAAACTGGAGG + Intergenic
1184786188 22:46673113-46673135 TTATAGACTCCTTAAACTTGAGG + Intronic
949599518 3:5582787-5582809 GGACAGACTTTTTAAAATGCTGG - Intergenic
952273006 3:31851175-31851197 GTACAGACTGGTTAAACTTGAGG - Intronic
955685654 3:61546189-61546211 CTACAAACTCTTTGAAATGGAGG - Intergenic
957641545 3:82860127-82860149 GTATAGTCTGGTTAAAATGGGGG + Intergenic
959716661 3:109441103-109441125 GTACATACTCCTTAGGATGCAGG + Intergenic
959760843 3:109962859-109962881 GTACAGAATCCTTAAAGTTGTGG - Intergenic
960099550 3:113725952-113725974 ATACAGACTACTTAAATAGGGGG - Intronic
965542461 3:169883666-169883688 TTCCAGTCTCCTTAAAGTGGAGG + Intergenic
966301508 3:178484625-178484647 GTACAGACTCCTCAAGATGGAGG + Intronic
972815464 4:42640459-42640481 TAACAGACTGCTTAAAAGGGAGG + Intronic
973835125 4:54801979-54802001 ATACACACTCCTGAAAATTGAGG - Intergenic
973932506 4:55807181-55807203 ATACAGCCTCCTTAAAATAGGGG + Intergenic
974326182 4:60418307-60418329 GAACATACTCCTTAACTTGGAGG + Intergenic
974334848 4:60529023-60529045 ATACAGACTTCTTAAATTTGTGG - Intergenic
975199759 4:71573244-71573266 CTATAGATTTCTTAAAATGGAGG + Intergenic
980721704 4:136705880-136705902 AAACAGACTCCTTAAAATAATGG + Intergenic
980955326 4:139422348-139422370 CTACATTCTACTTAAAATGGGGG + Intergenic
982037162 4:151356969-151356991 GTACCCAGTCCTTAAAATGCTGG + Intergenic
987971929 5:24958118-24958140 TTACAAACTGCTTAAAGTGGAGG + Intergenic
1002733818 5:181366298-181366320 GTACTGAGTACTTAAAAGGGTGG + Intergenic
1007380300 6:41485863-41485885 GAACAGAGTCCCTAAGATGGAGG - Intergenic
1009899266 6:69792058-69792080 GTAGAGACTTCTTGAAATTGTGG - Intronic
1010741932 6:79517326-79517348 GTTCAGACTCCTTAATTGGGTGG + Intronic
1013325543 6:109042911-109042933 ATACAGCCTCATGAAAATGGAGG + Intronic
1014350002 6:120329360-120329382 GTACAGACTCCTTGAGATCAAGG - Intergenic
1018303943 6:162434316-162434338 GCACAGACTCATTTGAATGGAGG - Intronic
1018333817 6:162762418-162762440 GTACAAACTCCTTAACAAGGAGG - Intronic
1018646275 6:165951655-165951677 GAACAGACTCGTCTAAATGGGGG - Intronic
1021539848 7:21745428-21745450 GTGCAAATTCTTTAAAATGGGGG + Intronic
1022766359 7:33416686-33416708 TTATAGACTCCTTAATATTGGGG - Intronic
1023592299 7:41793188-41793210 TTCCATACTCCTTAAAATAGTGG + Intergenic
1026403066 7:70036029-70036051 GGACAGACTGCTTTGAATGGGGG + Intronic
1030160485 7:106503355-106503377 GTAATGTCTCCTGAAAATGGAGG - Intergenic
1030527370 7:110670769-110670791 ATACTGACTCCTCAAAATAGGGG + Intronic
1035289620 7:157829600-157829622 GTGAAGACTCCTTACAAAGGCGG + Intronic
1059570852 9:115433814-115433836 TTTCAGATTCATTAAAATGGGGG + Intergenic
1188377126 X:29444875-29444897 GTACAGACAAATTAAAAAGGTGG + Intronic
1189943704 X:46154930-46154952 GAACAGACTCTTTACAAAGGAGG - Intergenic
1194301392 X:92190798-92190820 CTAAAGACTAGTTAAAATGGGGG - Intronic
1194412178 X:93570924-93570946 GTACAGAGTGCTTGAAAGGGGGG + Intergenic
1196905331 X:120425949-120425971 GTACAGACACCTCAAATAGGGGG - Intergenic