ID: 1068753412

View in Genome Browser
Species Human (GRCh38)
Location 10:60623057-60623079
Sequence CAAGTACAGACTCCTTAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 241}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068753412_1068753416 17 Left 1068753412 10:60623057-60623079 CCATTTTAAGGAGTCTGTACTTG 0: 1
1: 0
2: 1
3: 20
4: 241
Right 1068753416 10:60623097-60623119 TGGGTCTTCCCCCAGAAGGTAGG No data
1068753412_1068753415 13 Left 1068753412 10:60623057-60623079 CCATTTTAAGGAGTCTGTACTTG 0: 1
1: 0
2: 1
3: 20
4: 241
Right 1068753415 10:60623093-60623115 GTATTGGGTCTTCCCCCAGAAGG No data
1068753412_1068753414 -2 Left 1068753412 10:60623057-60623079 CCATTTTAAGGAGTCTGTACTTG 0: 1
1: 0
2: 1
3: 20
4: 241
Right 1068753414 10:60623078-60623100 TGTGACAGTAAACATGTATTGGG No data
1068753412_1068753413 -3 Left 1068753412 10:60623057-60623079 CCATTTTAAGGAGTCTGTACTTG 0: 1
1: 0
2: 1
3: 20
4: 241
Right 1068753413 10:60623077-60623099 TTGTGACAGTAAACATGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068753412 Original CRISPR CAAGTACAGACTCCTTAAAA TGG (reversed) Intronic
902463146 1:16594793-16594815 GAAGAACAGACCCCTAAAAAGGG - Intronic
903158367 1:21465933-21465955 GAAGAACAGACCCCTAAAAAGGG + Intronic
905456029 1:38088442-38088464 AAAGTTCACACTCCTTAGAAGGG - Intergenic
905743623 1:40393853-40393875 CACGCAAATACTCCTTAAAAAGG - Intronic
906777967 1:48547137-48547159 AAAGTCCAGACTCCTTAAGGTGG - Intronic
906868749 1:49452398-49452420 CAAGGTCAAACTCCTTAATAAGG + Intronic
907167276 1:52424818-52424840 CAAGTCCAAACTCCATAATATGG + Intronic
907853198 1:58276630-58276652 AAAGTCCAGGCTCCTTAATAGGG - Intronic
909212578 1:72843269-72843291 TAAATATAGAGTCCTTAAAAGGG + Intergenic
909347967 1:74614718-74614740 AAAGAACAGACTTATTAAAAAGG + Intronic
909600067 1:77451869-77451891 TAAGCACAGACTGCTTCAAATGG - Intronic
910783069 1:90962888-90962910 CAAGGAAAGACTTCTTAAATGGG + Intronic
910783148 1:90964111-90964133 CAAATACAGTATCTTTAAAAGGG + Intronic
911790076 1:102003807-102003829 CAAGTGTGGAGTCCTTAAAATGG + Intergenic
912658145 1:111505848-111505870 CAAGTCCAGACTCCTTAGAGTGG + Intronic
913223380 1:116677476-116677498 AAGGTTCAGACTCCTTAAAATGG + Intergenic
913991245 1:143614185-143614207 GAAGAACAGACCCCTAAAAAGGG - Intergenic
915053795 1:153106168-153106190 CAAGAACAGACACTTTCAAAAGG + Exonic
916837831 1:168566773-168566795 CAAGGAAAGACTCCTTAGGATGG + Intergenic
917635735 1:176934057-176934079 TTACTACAGACTCCTTAAAATGG + Intronic
918118534 1:181517378-181517400 AAAGTACAGACTACTCAGAATGG - Intronic
919082407 1:192882450-192882472 TAAGTTCAGACTTTTTAAAATGG - Intergenic
1064760174 10:18610879-18610901 AAAGTATAGTCTCATTAAAAGGG + Intronic
1065626514 10:27635033-27635055 CAAGTTCAGGCTGCTAAAAATGG - Intergenic
1066004193 10:31132511-31132533 CAAGTAGATGCTCCTCAAAAAGG - Intergenic
1068631461 10:59302996-59303018 AAAATACAGACTCCTTACAATGG + Intronic
1068753412 10:60623057-60623079 CAAGTACAGACTCCTTAAAATGG - Intronic
1070236721 10:74635277-74635299 CAACTACAGATTCCTTACAGTGG + Intronic
1071617787 10:87092858-87092880 CAAGTTCAGACTCCAAAGAAAGG - Intronic
1071751812 10:88487532-88487554 CCACTACACACTCGTTAAAATGG + Intronic
1072412857 10:95220300-95220322 CAAGTACAGAATGCTTATTATGG - Intronic
1072818908 10:98536951-98536973 AAAATTCAGATTCCTTAAAATGG - Intronic
1073761871 10:106637918-106637940 CAAGTACAGAAGACATAAAAGGG - Intronic
1073960644 10:108923548-108923570 CAAGTTCAGACTCCCTACACTGG + Intergenic
1076230820 10:128818687-128818709 CAGGTACAGACTCCTTGGCAAGG - Intergenic
1078041427 11:7867138-7867160 AAAGTCCAAACTCCTTAATATGG - Intergenic
1078314353 11:10280246-10280268 AAAGTACATACTCTTTAGAAGGG + Intronic
1078925312 11:15869589-15869611 CAAGTCCAAACTCCTAAAGATGG - Intergenic
1079673492 11:23197909-23197931 CTAATACAGAGTCTTTAAAAGGG - Intergenic
1085365730 11:75941872-75941894 AAAGTACAGAATCCTGGAAAAGG + Intronic
1087318515 11:96632790-96632812 CAAGTACAGAAAACCTAAAATGG - Intergenic
1088096985 11:106112922-106112944 CAAGTATAAAGTCCTTAATATGG + Intergenic
1088503258 11:110505693-110505715 CAAGGACAGAGTCATTTAAATGG - Intergenic
1088518667 11:110668788-110668810 CAATTACAGACTGCCAAAAAAGG - Intronic
1088891876 11:114050979-114051001 CAAGACCAGCCTCTTTAAAATGG + Intergenic
1088928424 11:114325328-114325350 CAAGTTCAGACCCCTTAGCATGG + Intergenic
1089413514 11:118267130-118267152 CAAGTCCACACTCCTTAGGATGG - Intergenic
1090833010 11:130432452-130432474 GAATTCCAGACTCCTTAAAACGG + Intergenic
1091016699 11:132057948-132057970 CAAGCACAGACTTGTGAAAAAGG - Intronic
1092299538 12:7232900-7232922 CAAGTACAGAACCCTTATTATGG - Intergenic
1093707950 12:22296107-22296129 CAAGTGCAGAGGCCTTAAAGAGG + Intronic
1097842659 12:64337111-64337133 CAGGGACAGATACCTTAAAAAGG + Intronic
1098794592 12:74873165-74873187 GAATTACAAACTCCTTAAACTGG + Intergenic
1100327659 12:93554342-93554364 CAAGTCCAAACTCCTTATCATGG - Intergenic
1100344259 12:93711624-93711646 CAAGTACAAAACCCCTAAAATGG - Intronic
1100912684 12:99383374-99383396 AAAATCCAGACTCTTTAAAATGG + Intronic
1101229306 12:102723444-102723466 CAAACACAGACTCCTTAACCTGG - Intergenic
1101274036 12:103179609-103179631 AAAGTACAGATGCTTTAAAATGG - Intergenic
1101864694 12:108511952-108511974 CTAGTACAGAATGCTTAAGATGG + Intergenic
1101892245 12:108727502-108727524 AAAGTTCAGACTCCTTAATGAGG - Intronic
1101946658 12:109142468-109142490 CCAGTAAAGACCCCTCAAAATGG - Intronic
1104655999 12:130574478-130574500 CAACCACAGACTTCTTTAAAAGG - Intronic
1107059090 13:36136162-36136184 CAAGTCCACATTCCTTAATAAGG - Intergenic
1108095744 13:46898653-46898675 CAAGTACAGAGACATAAAAATGG - Intergenic
1110138039 13:72092314-72092336 GAAGTCCAGATTCCTTACAATGG + Intergenic
1111911643 13:94319762-94319784 AAAATACAGATTACTTAAAAGGG - Intronic
1116627451 14:47283672-47283694 AAAGTATAGTCTCCTGAAAATGG - Intronic
1117979618 14:61329535-61329557 AAAGTCCAGAGTCTTTAAAATGG + Intronic
1118842670 14:69524789-69524811 AAAGTACAAACTCCTTAGCATGG + Intronic
1119814312 14:77551683-77551705 AAAGTAGAAACTCTTTAAAAAGG + Intronic
1120800534 14:88683321-88683343 CAAATTCAGGCTCCTTTAAAGGG - Intronic
1122128003 14:99589641-99589663 CATCTACAGACTCCTTAACTGGG - Intronic
1122794842 14:104200979-104201001 CAAGTACAGACCCCTCAGGAAGG + Intergenic
1125841608 15:42806479-42806501 AAAATCCAAACTCCTTAAAAAGG + Intronic
1126923017 15:53548750-53548772 CTAGTTCTGACCCCTTAAAATGG + Intronic
1127085146 15:55417636-55417658 CTAGTACAGAATGTTTAAAAAGG + Intronic
1127742218 15:61921822-61921844 CATGGACAGAGCCCTTAAAAGGG + Intronic
1127755463 15:62087653-62087675 CAAGCACAGCCTCCTGTAAAGGG + Intergenic
1128833517 15:70790627-70790649 CTAGTACAAACTCCTTATCATGG - Intergenic
1129335359 15:74848904-74848926 CAAGCACTGACCCCTTAAATTGG - Intronic
1129860209 15:78854800-78854822 AAAGTCCAAACTCCTTAACAAGG - Intronic
1130006594 15:80105028-80105050 TAAGTTCAGACTCCTTATCATGG + Intronic
1130217183 15:81983443-81983465 CAAGTCCAGTCTCCTCAGAATGG - Intergenic
1131638246 15:94260518-94260540 CAAGTTCAAAGTCCTTAATATGG - Intronic
1133094753 16:3435737-3435759 CAAGTCCAGCCTCCAGAAAAGGG + Exonic
1133547597 16:6823114-6823136 CAAATACAGGCTTCATAAAATGG - Intronic
1135792574 16:25410824-25410846 AAAGTATATACTCCTTATAAAGG + Intergenic
1139336217 16:66233324-66233346 AAAGTTCACACTCATTAAAAAGG - Intergenic
1144132734 17:12263754-12263776 CCAGTACAGACTCTCAAAAAAGG - Intergenic
1145414075 17:22699125-22699147 CAAAGACAGACTCATTAAAAAGG - Intergenic
1145913651 17:28557359-28557381 AAAGTTCAAACTCCTTAACATGG + Intronic
1147488826 17:40844706-40844728 CAAGTCCAAATTCCTTAAAATGG - Intergenic
1148001683 17:44391755-44391777 AAAGTTCAGATTCCTTAATATGG - Intergenic
1148944960 17:51253304-51253326 GAAGGACAGATTCCTAAAAATGG - Intronic
1154110093 18:11560278-11560300 CAAGTACATCATCCTTAAATGGG + Intergenic
1155192918 18:23447280-23447302 CAACTATGTACTCCTTAAAAAGG - Intergenic
1155263457 18:24067841-24067863 AAAGTACAGACTTCTTAATGTGG + Intronic
1155438471 18:25836819-25836841 AAAGTACAGACTCCTGAGTAGGG + Intergenic
1159325670 18:66913177-66913199 CAAATATTGTCTCCTTAAAAAGG + Intergenic
1159823227 18:73173157-73173179 AAGGTTCAGACTTCTTAAAATGG - Intronic
1160174473 18:76581256-76581278 AAAGTCCACACTCCTTCAAAAGG - Intergenic
1165730282 19:38140731-38140753 CGAGTGAATACTCCTTAAAATGG - Intronic
1166635344 19:44446437-44446459 GAAGTACAGACTCATTCAAAAGG - Intronic
1202678807 1_KI270711v1_random:32226-32248 GAAGAACAGACCCCTAAAAAGGG - Intergenic
926593752 2:14767581-14767603 AGAGGGCAGACTCCTTAAAATGG + Intergenic
929136750 2:38631893-38631915 CTAGTACAGATTTCTGAAAATGG - Intergenic
930798484 2:55419076-55419098 CAAATACATACTCTGTAAAATGG - Exonic
931424133 2:62155606-62155628 CCACTACATACTCATTAAAATGG - Intergenic
933307650 2:80621805-80621827 CATGTACAGACTCCTCAAAGAGG - Intronic
933859431 2:86450084-86450106 GAAGTGCAGAGTTCTTAAAAGGG - Intronic
935319518 2:101872223-101872245 AAAGAACAAACTCCTTAACAGGG - Intronic
935925214 2:108060944-108060966 CAGGTACAGACTACAGAAAATGG - Intergenic
935972179 2:108540501-108540523 AAAGTACAGATTCTTTTAAAGGG + Intronic
936254546 2:110900690-110900712 CAAGAACAGACTCAGTACAAAGG + Intronic
937890943 2:126938212-126938234 CAAGTACAAACTCCTTGGTAAGG + Intergenic
937968751 2:127534180-127534202 CAAATACAGACTGTTTAGAAGGG - Intergenic
940026420 2:149213268-149213290 AAAGAACAGACTCCATACAAAGG + Intronic
940677634 2:156744501-156744523 CAAGTGCAAACTCCTTAGCATGG - Intergenic
941381217 2:164794630-164794652 CAAGTGCACACTCCTGAACAAGG + Intronic
941850480 2:170175207-170175229 CAAGTAAAAACACCTTAAGAAGG - Intergenic
942591158 2:177548102-177548124 CAAGCACAGACTCCTTTGATGGG - Intergenic
944458011 2:199915953-199915975 AAAGTACAGAATTTTTAAAAAGG - Intronic
945159124 2:206870937-206870959 CAAGTTCAGACCCCTTAGATTGG + Intergenic
1169293839 20:4375640-4375662 GAAGTACAAACTGTTTAAAAAGG + Intergenic
1172226599 20:33309565-33309587 CAAATACAGAATTCTTAGAAGGG - Intronic
1173078229 20:39841332-39841354 CAAGTACACTCTTCTTAGAAGGG - Intergenic
1175253430 20:57623289-57623311 CTGCTACAGACTCCTAAAAATGG - Intergenic
1177298637 21:19210957-19210979 CAAGTTCAGACTACTCAAAGTGG + Intergenic
1177397250 21:20552889-20552911 CTAGAAAAGACTCATTAAAATGG - Intergenic
1178301913 21:31460160-31460182 AGAGGACAAACTCCTTAAAATGG - Intronic
949323858 3:2842081-2842103 GAAGAACACACTCCTTAAAATGG - Intronic
950313445 3:11979136-11979158 CAAGTTGAAACTCCTTAAATTGG - Intergenic
950419237 3:12887219-12887241 CAGAAACAGACTCCATAAAATGG - Intergenic
950960026 3:17095254-17095276 CAAGAACAAACTCCCTAACAAGG - Intergenic
951141015 3:19160202-19160224 TAAGTACAGTCTTCTTAAATCGG - Intronic
953376415 3:42432029-42432051 GAAGAACAGACTCCCTAAATTGG - Intergenic
953509012 3:43516496-43516518 AAAGTCCAGCCTCCTTAACAAGG - Intronic
955123724 3:56088229-56088251 CAAGTCCTCAATCCTTAAAACGG + Intronic
955661288 3:61302272-61302294 CCAGTACATGCTCCCTAAAAAGG - Intergenic
957167171 3:76690241-76690263 CAAGGACCAACTCCTTAATATGG - Intronic
957641542 3:82860124-82860146 CAAGTATAGTCTGGTTAAAATGG + Intergenic
959795025 3:110416250-110416272 CAAGGACACACTCTTCAAAAGGG - Intergenic
960683709 3:120275560-120275582 CAAATGCAGAGTACTTAAAAGGG - Intronic
960882160 3:122356080-122356102 CAGGTACAAATTCCTTAAAGTGG - Intergenic
961102072 3:124208041-124208063 CCAGTTCAGTGTCCTTAAAATGG + Intronic
962860361 3:139394170-139394192 AAAGTCCAGACTCCTTTAACTGG - Intergenic
963536141 3:146530777-146530799 CAAATCCAGACTCCTTACTAAGG - Intronic
963984623 3:151577338-151577360 AAAGGACAGACCCCTTAATATGG - Intergenic
964584008 3:158275385-158275407 CAGGTACAGACTTTTTAAATTGG - Intronic
965337899 3:167450380-167450402 CAAGTATAGTCTCCTCAAGAAGG + Intronic
966459132 3:180155799-180155821 TAAATTCAGACTCTTTAAAATGG - Intergenic
966796421 3:183718893-183718915 CAAGAACAGACTGGTCAAAATGG - Intronic
967265122 3:187684081-187684103 TAAGTACAGACTCCAGAAACAGG + Intergenic
968317664 3:197737623-197737645 AAAATCCAAACTCCTTAAAATGG - Intronic
969659369 4:8517651-8517673 CAAAGACAGACTTCTTGAAAGGG - Intergenic
970130418 4:12863475-12863497 TAAGTACAGACTACTTAAGAAGG + Intergenic
970335101 4:15029877-15029899 GAAGTACTGTATCCTTAAAAGGG - Intronic
970961660 4:21878517-21878539 AAAGTACATACTTCTTGAAAGGG - Intronic
972152037 4:36104634-36104656 ATATTACAGATTCCTTAAAAGGG + Intronic
972802188 4:42488623-42488645 AAAGTCTAAACTCCTTAAAATGG + Intronic
972897621 4:43643376-43643398 CAAGTACAACCTCCTTGTAATGG + Intergenic
975091096 4:70405184-70405206 CAAATGTAGACTCCTTAAGAAGG + Intronic
975839741 4:78460824-78460846 CAACTACAGACTGCATATAATGG - Intronic
975875832 4:78835994-78836016 CAACTACAGACACCATTAAATGG - Intronic
976848387 4:89516115-89516137 TAAGTAATGACTTCTTAAAAAGG + Intergenic
979736912 4:124097991-124098013 CAAGTACATATTTTTTAAAAGGG - Intergenic
980572605 4:134640231-134640253 CAAGCACAGTCTTCTTAAAAAGG - Intergenic
980722467 4:136716522-136716544 CAAGTCCAGAGTCCCTGAAAGGG - Intergenic
984055300 4:174921308-174921330 CAAGTGAAGTCTTCTTAAAAAGG + Intronic
985427564 4:189845823-189845845 CAAATACAAACTCCAAAAAAGGG - Intergenic
987337837 5:16912702-16912724 GAAATACAGACTGTTTAAAAGGG - Intronic
988449703 5:31328968-31328990 CAAATACGCACTCCTTGAAATGG + Exonic
988786434 5:34569590-34569612 AAAGTACACACTCAATAAAAGGG + Intergenic
989190980 5:38669350-38669372 CAAGTAAAGAATCCTAAAATTGG - Intergenic
990274914 5:54184989-54185011 AAAGTACAGACTCCTTATCTGGG + Intronic
991267935 5:64744972-64744994 TAAAGTCAGACTCCTTAAAAAGG - Intronic
992712249 5:79471230-79471252 AAAATACAAAGTCCTTAAAATGG + Intronic
993089024 5:83400737-83400759 CAAGTACAAACTCCAAAAAAAGG + Intergenic
993484711 5:88468763-88468785 GAAGGACAGGGTCCTTAAAACGG - Intergenic
993534199 5:89061238-89061260 AAAGTACAGTCTCTTTAAAGTGG + Intergenic
994323050 5:98415286-98415308 CAACTCCACAGTCCTTAAAAAGG + Intergenic
995913186 5:117212486-117212508 CAAGTACTCACTCGTTAACATGG + Intergenic
996421018 5:123262719-123262741 CAAGTCCAAACTTCTTAAAGTGG + Intergenic
996891080 5:128421169-128421191 CAAGGACAGATTACTGAAAATGG - Intronic
997752392 5:136358895-136358917 CAAGTACTTACTCTTTAAAACGG - Intronic
997832166 5:137159248-137159270 AAAATACAGACTTCTTAAAATGG + Intronic
997832315 5:137161248-137161270 AAAATACAGACTTCTTAAAATGG + Intronic
1001187625 5:169590459-169590481 CAAGTACGAACTCCTTCAAGAGG - Intronic
1001225547 5:169941603-169941625 CAAGTCCAGATTCCTTAAGATGG - Intronic
1001456630 5:171866692-171866714 CAAGTAAAAACTGCTTAAAGAGG - Intronic
1002049500 5:176562132-176562154 AGAGTCCAGACTCCATAAAAGGG - Intronic
1002422023 5:179153850-179153872 CAAGGACAGACCCCTGACAATGG + Intronic
1004363085 6:14988150-14988172 CAATTACAGACTCTCTCAAAAGG + Intergenic
1005787159 6:29256165-29256187 CAAATAGAGACTACTAAAAAGGG - Intergenic
1007440900 6:41859149-41859171 AAAGTCCAAACTCCTTAACATGG + Intronic
1008455719 6:51708511-51708533 CAAGTCCCAACTCCTTAACATGG + Intronic
1010267834 6:73886759-73886781 TAAGTAATGACTCCTGAAAAAGG + Intergenic
1010541828 6:77100791-77100813 CAAGTACAAAATCCTTAAGAAGG + Intergenic
1010741931 6:79517323-79517345 AAAGTTCAGACTCCTTAATTGGG + Intronic
1011528112 6:88288867-88288889 AAACCACAGACTCCTTGAAATGG - Intergenic
1012433186 6:99187691-99187713 CAACTCCAGAGTGCTTAAAATGG - Intergenic
1014598409 6:123375147-123375169 CAAGAATAGAAACCTTAAAAGGG + Intronic
1015378437 6:132537100-132537122 AAAGTACAGATTCCTAGAAAAGG - Intergenic
1015617494 6:135092683-135092705 AAAGTACAGACTCCTTAGCCGGG + Intronic
1016156041 6:140809618-140809640 CAAGTTCAGGCTCCTTGGAAAGG - Intergenic
1018333818 6:162762421-162762443 GAAGTACAAACTCCTTAACAAGG - Intronic
1020046117 7:5041818-5041840 CAAGGAAATACTCTTTAAAAAGG - Intronic
1020395459 7:7711462-7711484 GAAGTACAATATCCTTAAAAAGG - Intronic
1021242690 7:18223927-18223949 CAATTACAGACTATTTTAAAAGG - Intronic
1024578723 7:50784704-50784726 CAAGAACAGAATCTTTGAAAAGG + Intronic
1026087550 7:67274971-67274993 CAAGGAAATACTCTTTAAAAAGG + Intergenic
1026176227 7:68000036-68000058 CAAATCCAGACTCCTTAGCATGG + Intergenic
1026368497 7:69674167-69674189 CAAGTACAGAATCAGTGAAATGG - Intronic
1026726685 7:72875276-72875298 CAAGGAAATACTCTTTAAAAAGG - Intergenic
1027117154 7:75490337-75490359 CAAGGAAATACTCTTTAAAAAGG + Intergenic
1027274655 7:76545262-76545284 CAAGGAAATACTCTTTAAAAAGG - Intergenic
1028271883 7:88801492-88801514 CAACTGCAGAGTTCTTAAAAGGG - Intronic
1028663611 7:93314289-93314311 CAAGTAAATACTACTTGAAAAGG - Intronic
1029720348 7:102359728-102359750 CAAGGAAATACTCTTTAAAAAGG - Intergenic
1030689257 7:112516078-112516100 CAAGTCCAAACTCCTTAGAATGG + Intergenic
1031273527 7:119687180-119687202 CCTGTACATACTCCTAAAAATGG - Intergenic
1032155677 7:129465709-129465731 CAAGTCCAAACTCCTTAGCATGG - Intronic
1035348764 7:158227914-158227936 CCAGCACAGACTCCTTGACATGG + Intronic
1035822980 8:2614959-2614981 AAACTGCAGACTCCTTGAAAGGG - Intergenic
1035976212 8:4314486-4314508 AAAGTCCAGACTGCTTAGAAAGG - Intronic
1039582743 8:38680347-38680369 CAAGTCCAAAGTCCTTAAAGTGG - Intergenic
1041050508 8:53930106-53930128 TAAGAACAGATACCTTAAAAAGG + Intronic
1041279044 8:56193139-56193161 AAAGTACAGACTCTTTTTAAAGG - Intronic
1041696778 8:60744252-60744274 TAAGTCCAAATTCCTTAAAAAGG - Intronic
1042391623 8:68242335-68242357 AAATTACAAACTCCTTAATATGG - Intergenic
1043360715 8:79468800-79468822 CAAGTACACACTCAAGAAAAGGG + Intergenic
1043406219 8:79936743-79936765 CAAGCACAGATTTTTTAAAAGGG - Intronic
1045051857 8:98334716-98334738 AAAGTCCAGATTCCTTCAAACGG + Intergenic
1045133175 8:99181052-99181074 TAAGGACAAACTCCTAAAAATGG - Intronic
1045558664 8:103239564-103239586 CAAGTACATGCTCCTTAGGATGG - Intergenic
1045624257 8:104024075-104024097 CAAGTGCAGACACCTTTGAAAGG + Intronic
1046137366 8:110046058-110046080 CATTTACAGACTCCTTAAGCTGG - Intergenic
1046740554 8:117823601-117823623 TAAGTACAGACTATTTTAAATGG + Intronic
1047597237 8:126391200-126391222 CAAGTGTAGACTCCTTTTAATGG - Intergenic
1048124853 8:131623067-131623089 CAACTACAGACTCCTTAGAATGG + Intergenic
1050040725 9:1490556-1490578 CAAGTACAGCCTCATGAAACTGG + Intergenic
1051311619 9:15780148-15780170 CAAGTAGATACACCTTCAAAGGG + Intronic
1052027163 9:23586346-23586368 CAAGTACTCACTACCTAAAAAGG - Intergenic
1054932929 9:70654667-70654689 AAACTACAGAGTGCTTAAAAAGG - Intronic
1056749930 9:89341705-89341727 AAAGAACAGTCTCTTTAAAATGG + Intronic
1057126813 9:92623055-92623077 CAAAGAAAGACTTCTTAAAAGGG + Intronic
1059440530 9:114304371-114304393 TAAGTTCAGACTCCTCAACATGG - Intronic
1059970929 9:119667386-119667408 CAAGCACTGACTCATTAGAATGG - Intergenic
1060261491 9:122078855-122078877 AAAGTTCAGACTCCTTATGAAGG - Intronic
1186696323 X:12036797-12036819 CAAATAAACACTTCTTAAAAGGG - Intergenic
1186799377 X:13078180-13078202 CAAGTACAGGGTGCTCAAAATGG + Intergenic
1186821168 X:13289512-13289534 CAAGGGAAGAATCCTTAAAACGG + Intergenic
1187507576 X:19889097-19889119 CAATATCAGACTCCTAAAAAAGG + Intergenic
1187552411 X:20319156-20319178 CAACTCCAGACTCCTTAACCTGG + Intergenic
1187741394 X:22359738-22359760 CCAGTACAGAATACCTAAAAAGG - Intergenic
1188404475 X:29790874-29790896 CAAGTCCAAACTCCTTATCATGG + Intronic
1189503013 X:41582270-41582292 AAACTGCAGACTCCTTACAATGG + Intronic
1190429358 X:50364585-50364607 GCAGTACAGACTTCTTAATATGG + Intergenic
1191971092 X:66817073-66817095 CAAGTACAAACTCCTGGAGATGG + Intergenic
1192275733 X:69629082-69629104 AAAGTTCAGACTTCTTAAACTGG + Intronic
1192479692 X:71474208-71474230 CAAGTCCAAACTCCTTACCATGG - Intronic
1194950284 X:100117883-100117905 CAACTACATACTCCTAAAGATGG + Intergenic
1200089272 X:153626767-153626789 CAAGGACAGTTTCCTTAGAAGGG + Intergenic