ID: 1068753416

View in Genome Browser
Species Human (GRCh38)
Location 10:60623097-60623119
Sequence TGGGTCTTCCCCCAGAAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068753412_1068753416 17 Left 1068753412 10:60623057-60623079 CCATTTTAAGGAGTCTGTACTTG 0: 1
1: 0
2: 1
3: 20
4: 241
Right 1068753416 10:60623097-60623119 TGGGTCTTCCCCCAGAAGGTAGG No data
1068753411_1068753416 20 Left 1068753411 10:60623054-60623076 CCACCATTTTAAGGAGTCTGTAC 0: 1
1: 0
2: 1
3: 9
4: 97
Right 1068753416 10:60623097-60623119 TGGGTCTTCCCCCAGAAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068753416 Original CRISPR TGGGTCTTCCCCCAGAAGGT AGG Intronic
No off target data available for this crispr