ID: 1068754565

View in Genome Browser
Species Human (GRCh38)
Location 10:60637027-60637049
Sequence GCTGGCACTATGGGCGTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 70}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068754565 Original CRISPR GCTGGCACTATGGGCGTGTT TGG (reversed) Intronic
902203526 1:14851369-14851391 GCTGGCAGTATGGGAGTGAGTGG - Intronic
902480625 1:16709762-16709784 GCTGGCAATATGGGCATGCAGGG + Intergenic
903811796 1:26038800-26038822 GCAGGCAGTATGGGCGCGCTGGG + Exonic
918268772 1:182874336-182874358 ACTGGCACTTTGGGAGTTTTTGG + Intronic
919967982 1:202548491-202548513 GCTGGGACTATAGGTGTGCTGGG + Intronic
921608681 1:217185050-217185072 GCTGGCACTATGCTAGTGTGGGG - Intergenic
922798679 1:228353919-228353941 GCTGCCACTGTGGGAGTGGTTGG + Intronic
1068739412 10:60451700-60451722 GCTGGCATTATGGTAGTGCTGGG + Intronic
1068754565 10:60637027-60637049 GCTGGCACTATGGGCGTGTTTGG - Intronic
1074459086 10:113620784-113620806 GCTGGCACCAAGGCTGTGTTGGG - Intronic
1092091067 12:5803977-5803999 GCTGGCAGGATGGGCAGGTTGGG + Intronic
1094828294 12:34288401-34288423 GCTGACACGCTGGGCCTGTTGGG - Intergenic
1096153798 12:49330872-49330894 GCTGGCACAAAGCGGGTGTTGGG - Exonic
1101397346 12:104359957-104359979 GCTGGCACAAAGGGGGTGCTAGG + Intergenic
1103506928 12:121447798-121447820 GCTGGGACTACAGGCGTGCTGGG + Intronic
1103525227 12:121563180-121563202 GCTGGGACTATGGGCATGCACGG - Intronic
1127668685 15:61173786-61173808 GCTGGGACTATAGGCATGTGGGG + Intronic
1128027830 15:64453451-64453473 GCAGTCACTATGGTAGTGTTAGG + Intronic
1131659289 15:94497102-94497124 CCTGGCACTGTGGACGTCTTGGG + Intergenic
1142468326 17:148272-148294 GCTGGCAAGAAGGGAGTGTTAGG + Intronic
1143007235 17:3845119-3845141 GCTGGCACTAAAGGCGTGCACGG + Intronic
1146326892 17:31893999-31894021 GCTGGGATTACGGGAGTGTTTGG - Intronic
1151946202 17:77321283-77321305 GTTGCCACTATGTGTGTGTTGGG + Intronic
1152351081 17:79784423-79784445 GCTGGCACCATGGGTGTGCGGGG - Exonic
1155370719 18:25097535-25097557 ACTGGCAATATGGGAGTGTCTGG + Intronic
1159653105 18:71000535-71000557 GGTGGCACTATGGTTGGGTTCGG + Intergenic
1163579740 19:18131244-18131266 GCTGGGACTATAGGCGTGAATGG - Intronic
1163794573 19:19329821-19329843 GCTGGGACTATAGGCATGTGTGG - Intronic
1165370459 19:35402463-35402485 GTTGGCACCATGGGCCTGTAGGG + Intergenic
1167463731 19:49639586-49639608 GGTGGCACCAAGGGCGTGGTGGG + Intronic
1168489256 19:56794669-56794691 GATGGCACTATTGGCTTGTAAGG - Intronic
1202714664 1_KI270714v1_random:35670-35692 GCTGGCAATATGGGCATGCCGGG + Intergenic
935268275 2:101412875-101412897 GCTTGCTTTATTGGCGTGTTGGG - Intronic
940574597 2:155485129-155485151 GCTTGGAATATGGGCATGTTAGG - Intergenic
941877223 2:170446385-170446407 GCTGGTACTATGGGTGTGGAAGG - Intronic
947387963 2:229611133-229611155 GCTGGGACTATGTGCCTGTGGGG - Intronic
1175186446 20:57182259-57182281 GCTGGCACTGTGGGCATCTGTGG - Intronic
1175724245 20:61306718-61306740 GCTGGCCCCAAGGGTGTGTTTGG - Intronic
1176960278 21:15151850-15151872 TTTGGCACTATGTGCGTTTTGGG + Intergenic
1182427074 22:30279564-30279586 GCTGGCAGGGTGGGTGTGTTGGG - Intergenic
949550086 3:5105284-5105306 CCTGGCACTATTGGCGTTTGGGG - Intergenic
950423832 3:12914233-12914255 GCTGGAGCTATGACCGTGTTGGG - Intronic
951532843 3:23713871-23713893 GCTGGTAATATGGGCTGGTTGGG + Intergenic
959136039 3:102422437-102422459 GCTGGCACTATTGATGTTTTGGG - Intronic
962350256 3:134651125-134651147 GCGGGCCCTAATGGCGTGTTTGG - Intronic
963728800 3:148950533-148950555 GCTGGCCCTATGGAAGTGGTAGG - Intergenic
968079284 3:195835342-195835364 GCTGGCACAATGAGAGTTTTGGG + Intergenic
969448070 4:7256740-7256762 GTTGGGACTATGGGGGTGTCGGG + Intronic
986180794 5:5391333-5391355 CCTGGCACTATTGACGTTTTAGG + Intergenic
996299976 5:121970033-121970055 TCTGGCAGTATTGGTGTGTTAGG + Intronic
1002381293 5:178831760-178831782 GCTGGCACTAGGGGCCAGGTTGG - Intergenic
1004108779 6:12693683-12693705 CCTGGCATTATGGGAGTGTCAGG + Intergenic
1007115887 6:39343052-39343074 GCTTGCCCTGTGGGTGTGTTGGG + Intronic
1009020887 6:57947311-57947333 CCTGGCACTATTGACGTTTTAGG + Intergenic
1010081447 6:71868787-71868809 GCTGGAACTATAGGCATGTGTGG - Intergenic
1011627402 6:89294610-89294632 GCCGGCACTTTGGGTGGGTTGGG + Intronic
1028207990 7:88038911-88038933 GCTGGGACTATAGGCATGTGAGG + Intronic
1031934226 7:127719421-127719443 GCTGGCATTAAGGGGCTGTTTGG + Intronic
1035165963 7:156990038-156990060 GGTGGCACTGTGTGCCTGTTGGG + Intergenic
1044751300 8:95418644-95418666 GCTGACACTGTGGGCCTGCTGGG - Intergenic
1048254645 8:132896527-132896549 GCTGGCACTTGGGGCAGGTTGGG - Intronic
1060367616 9:123034316-123034338 CCTGGCACTATGGCCGCGTCTGG + Intronic
1060622301 9:125078590-125078612 GCTGGCAGTATAGGGGTGGTGGG - Intronic
1061320216 9:129823718-129823740 GATGGCACTAGGGCCGGGTTGGG - Intronic
1185518795 X:721099-721121 GCTGTCGCGATGGGGGTGTTTGG + Intergenic
1189829523 X:44956658-44956680 GCTGGGATTATAGGCGTGCTGGG + Intronic
1190925359 X:54898854-54898876 GCTAGCACCTTGGGCGTCTTGGG + Intergenic
1199684898 X:150257273-150257295 GCTGGCAGTAAGGGCGAGTAGGG - Intergenic
1199885299 X:152015360-152015382 GCTAGCATTATGTGAGTGTTAGG + Intergenic
1202303797 Y:23446426-23446448 GCTGGGACTATAGGTGTGCTGGG + Intergenic
1202567013 Y:26224167-26224189 GCTGGGACTATAGGTGTGCTGGG - Intergenic