ID: 1068765440

View in Genome Browser
Species Human (GRCh38)
Location 10:60758173-60758195
Sequence GAAAATACAAAGATAAAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068765437_1068765440 25 Left 1068765437 10:60758125-60758147 CCGATTGAGGAATTCTCAACAAA No data
Right 1068765440 10:60758173-60758195 GAAAATACAAAGATAAAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068765440 Original CRISPR GAAAATACAAAGATAAAGCT AGG Intergenic
No off target data available for this crispr