ID: 1068770576

View in Genome Browser
Species Human (GRCh38)
Location 10:60816060-60816082
Sequence ATTCATATTGATCTGTATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068770573_1068770576 11 Left 1068770573 10:60816026-60816048 CCACACTTGTGTAGGTATTCACA No data
Right 1068770576 10:60816060-60816082 ATTCATATTGATCTGTATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068770576 Original CRISPR ATTCATATTGATCTGTATAT AGG Intergenic
No off target data available for this crispr