ID: 1068770693

View in Genome Browser
Species Human (GRCh38)
Location 10:60817597-60817619
Sequence CTCCTGGGTGGCCAGTAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068770684_1068770693 25 Left 1068770684 10:60817549-60817571 CCACAAGGTCTTGGTGTGACTGG No data
Right 1068770693 10:60817597-60817619 CTCCTGGGTGGCCAGTAGCCTGG No data
1068770683_1068770693 29 Left 1068770683 10:60817545-60817567 CCATCCACAAGGTCTTGGTGTGA No data
Right 1068770693 10:60817597-60817619 CTCCTGGGTGGCCAGTAGCCTGG No data
1068770689_1068770693 -10 Left 1068770689 10:60817584-60817606 CCTATCCACTGACCTCCTGGGTG No data
Right 1068770693 10:60817597-60817619 CTCCTGGGTGGCCAGTAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068770693 Original CRISPR CTCCTGGGTGGCCAGTAGCC TGG Intergenic
No off target data available for this crispr