ID: 1068771625

View in Genome Browser
Species Human (GRCh38)
Location 10:60828037-60828059
Sequence TTGACCTTGAGTCAAATGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068771623_1068771625 15 Left 1068771623 10:60827999-60828021 CCAGTGAAAACTAAGTTATGTAA No data
Right 1068771625 10:60828037-60828059 TTGACCTTGAGTCAAATGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068771625 Original CRISPR TTGACCTTGAGTCAAATGTC TGG Intergenic
No off target data available for this crispr