ID: 1068773834

View in Genome Browser
Species Human (GRCh38)
Location 10:60850723-60850745
Sequence CAGGAGGCCTAGAACTAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068773831_1068773834 5 Left 1068773831 10:60850695-60850717 CCTGATAGGGCTGGATGGCTGTG No data
Right 1068773834 10:60850723-60850745 CAGGAGGCCTAGAACTAAGCTGG No data
1068773829_1068773834 12 Left 1068773829 10:60850688-60850710 CCTTCATCCTGATAGGGCTGGAT No data
Right 1068773834 10:60850723-60850745 CAGGAGGCCTAGAACTAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068773834 Original CRISPR CAGGAGGCCTAGAACTAAGC TGG Intergenic
No off target data available for this crispr