ID: 1068775463

View in Genome Browser
Species Human (GRCh38)
Location 10:60863787-60863809
Sequence TGTGATTCCAGCACTTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068775463_1068775472 24 Left 1068775463 10:60863787-60863809 CCTCCCAAAGTGCTGGAATCACA No data
Right 1068775472 10:60863834-60863856 TGCATCCTTTTAAACTTGTCTGG No data
1068775463_1068775473 25 Left 1068775463 10:60863787-60863809 CCTCCCAAAGTGCTGGAATCACA No data
Right 1068775473 10:60863835-60863857 GCATCCTTTTAAACTTGTCTGGG No data
1068775463_1068775467 -8 Left 1068775463 10:60863787-60863809 CCTCCCAAAGTGCTGGAATCACA No data
Right 1068775467 10:60863802-60863824 GAATCACAGGCATGATCCACTGG No data
1068775463_1068775468 -4 Left 1068775463 10:60863787-60863809 CCTCCCAAAGTGCTGGAATCACA No data
Right 1068775468 10:60863806-60863828 CACAGGCATGATCCACTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068775463 Original CRISPR TGTGATTCCAGCACTTTGGG AGG (reversed) Intergenic