ID: 1068775465

View in Genome Browser
Species Human (GRCh38)
Location 10:60863790-60863812
Sequence GCCTGTGATTCCAGCACTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068775465_1068775472 21 Left 1068775465 10:60863790-60863812 CCCAAAGTGCTGGAATCACAGGC No data
Right 1068775472 10:60863834-60863856 TGCATCCTTTTAAACTTGTCTGG No data
1068775465_1068775468 -7 Left 1068775465 10:60863790-60863812 CCCAAAGTGCTGGAATCACAGGC No data
Right 1068775468 10:60863806-60863828 CACAGGCATGATCCACTGGCTGG No data
1068775465_1068775473 22 Left 1068775465 10:60863790-60863812 CCCAAAGTGCTGGAATCACAGGC No data
Right 1068775473 10:60863835-60863857 GCATCCTTTTAAACTTGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068775465 Original CRISPR GCCTGTGATTCCAGCACTTT GGG (reversed) Intergenic