ID: 1068775468

View in Genome Browser
Species Human (GRCh38)
Location 10:60863806-60863828
Sequence CACAGGCATGATCCACTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068775459_1068775468 6 Left 1068775459 10:60863777-60863799 CCCACCTCGGCCTCCCAAAGTGC No data
Right 1068775468 10:60863806-60863828 CACAGGCATGATCCACTGGCTGG No data
1068775463_1068775468 -4 Left 1068775463 10:60863787-60863809 CCTCCCAAAGTGCTGGAATCACA No data
Right 1068775468 10:60863806-60863828 CACAGGCATGATCCACTGGCTGG No data
1068775456_1068775468 20 Left 1068775456 10:60863763-60863785 CCTCAAGTGATCCGCCCACCTCG No data
Right 1068775468 10:60863806-60863828 CACAGGCATGATCCACTGGCTGG No data
1068775455_1068775468 25 Left 1068775455 10:60863758-60863780 CCTGACCTCAAGTGATCCGCCCA No data
Right 1068775468 10:60863806-60863828 CACAGGCATGATCCACTGGCTGG No data
1068775465_1068775468 -7 Left 1068775465 10:60863790-60863812 CCCAAAGTGCTGGAATCACAGGC No data
Right 1068775468 10:60863806-60863828 CACAGGCATGATCCACTGGCTGG No data
1068775466_1068775468 -8 Left 1068775466 10:60863791-60863813 CCAAAGTGCTGGAATCACAGGCA No data
Right 1068775468 10:60863806-60863828 CACAGGCATGATCCACTGGCTGG No data
1068775458_1068775468 9 Left 1068775458 10:60863774-60863796 CCGCCCACCTCGGCCTCCCAAAG No data
Right 1068775468 10:60863806-60863828 CACAGGCATGATCCACTGGCTGG No data
1068775460_1068775468 5 Left 1068775460 10:60863778-60863800 CCACCTCGGCCTCCCAAAGTGCT No data
Right 1068775468 10:60863806-60863828 CACAGGCATGATCCACTGGCTGG No data
1068775462_1068775468 2 Left 1068775462 10:60863781-60863803 CCTCGGCCTCCCAAAGTGCTGGA No data
Right 1068775468 10:60863806-60863828 CACAGGCATGATCCACTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068775468 Original CRISPR CACAGGCATGATCCACTGGC TGG Intergenic