ID: 1068775469

View in Genome Browser
Species Human (GRCh38)
Location 10:60863818-60863840
Sequence GGATGCAAGGGACCAGCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068775469_1068775472 -7 Left 1068775469 10:60863818-60863840 CCACTGGCTGGTCCCTTGCATCC No data
Right 1068775472 10:60863834-60863856 TGCATCCTTTTAAACTTGTCTGG No data
1068775469_1068775473 -6 Left 1068775469 10:60863818-60863840 CCACTGGCTGGTCCCTTGCATCC No data
Right 1068775473 10:60863835-60863857 GCATCCTTTTAAACTTGTCTGGG No data
1068775469_1068775478 23 Left 1068775469 10:60863818-60863840 CCACTGGCTGGTCCCTTGCATCC No data
Right 1068775478 10:60863864-60863886 TTCCCAGCTTCTGTGTTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068775469 Original CRISPR GGATGCAAGGGACCAGCCAG TGG (reversed) Intergenic