ID: 1068775473

View in Genome Browser
Species Human (GRCh38)
Location 10:60863835-60863857
Sequence GCATCCTTTTAAACTTGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068775463_1068775473 25 Left 1068775463 10:60863787-60863809 CCTCCCAAAGTGCTGGAATCACA No data
Right 1068775473 10:60863835-60863857 GCATCCTTTTAAACTTGTCTGGG No data
1068775469_1068775473 -6 Left 1068775469 10:60863818-60863840 CCACTGGCTGGTCCCTTGCATCC No data
Right 1068775473 10:60863835-60863857 GCATCCTTTTAAACTTGTCTGGG No data
1068775465_1068775473 22 Left 1068775465 10:60863790-60863812 CCCAAAGTGCTGGAATCACAGGC No data
Right 1068775473 10:60863835-60863857 GCATCCTTTTAAACTTGTCTGGG No data
1068775466_1068775473 21 Left 1068775466 10:60863791-60863813 CCAAAGTGCTGGAATCACAGGCA No data
Right 1068775473 10:60863835-60863857 GCATCCTTTTAAACTTGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068775473 Original CRISPR GCATCCTTTTAAACTTGTCT GGG Intergenic