ID: 1068775478

View in Genome Browser
Species Human (GRCh38)
Location 10:60863864-60863886
Sequence TTCCCAGCTTCTGTGTTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068775474_1068775478 2 Left 1068775474 10:60863839-60863861 CCTTTTAAACTTGTCTGGGTGCC No data
Right 1068775478 10:60863864-60863886 TTCCCAGCTTCTGTGTTCTTTGG No data
1068775469_1068775478 23 Left 1068775469 10:60863818-60863840 CCACTGGCTGGTCCCTTGCATCC No data
Right 1068775478 10:60863864-60863886 TTCCCAGCTTCTGTGTTCTTTGG No data
1068775470_1068775478 11 Left 1068775470 10:60863830-60863852 CCCTTGCATCCTTTTAAACTTGT No data
Right 1068775478 10:60863864-60863886 TTCCCAGCTTCTGTGTTCTTTGG No data
1068775471_1068775478 10 Left 1068775471 10:60863831-60863853 CCTTGCATCCTTTTAAACTTGTC No data
Right 1068775478 10:60863864-60863886 TTCCCAGCTTCTGTGTTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068775478 Original CRISPR TTCCCAGCTTCTGTGTTCTT TGG Intergenic