ID: 1068775783

View in Genome Browser
Species Human (GRCh38)
Location 10:60866286-60866308
Sequence CAATGTGTGCATCTAGTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068775783_1068775786 7 Left 1068775783 10:60866286-60866308 CCATGGACTAGATGCACACATTG No data
Right 1068775786 10:60866316-60866338 GCTGGATTTCCAGAACAGTGTGG No data
1068775783_1068775788 29 Left 1068775783 10:60866286-60866308 CCATGGACTAGATGCACACATTG No data
Right 1068775788 10:60866338-60866360 GAGTCAGAAAAGTAGATAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068775783 Original CRISPR CAATGTGTGCATCTAGTCCA TGG (reversed) Intergenic
No off target data available for this crispr