ID: 1068778542

View in Genome Browser
Species Human (GRCh38)
Location 10:60894261-60894283
Sequence TGGTCTGGTGCAGCTTTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068778542 Original CRISPR TGGTCTGGTGCAGCTTTTCT TGG (reversed) Intronic
900347064 1:2215007-2215029 TGGTGAGGTGCAGCTGTGCTAGG - Intergenic
900695188 1:4005308-4005330 TGGTATGTGGCAGCTCTTCTAGG - Intergenic
902696633 1:18144656-18144678 GGGTCCTGGGCAGCTTTTCTTGG - Intronic
903244775 1:22007386-22007408 GGGCCTGCTGCAGCTTGTCTGGG - Exonic
903276504 1:22225414-22225436 TTGTCTGGTGCAGCTTCTTTTGG - Intergenic
903301715 1:22383830-22383852 TGTCCTGTTCCAGCTTTTCTTGG - Intergenic
903401246 1:23051434-23051456 TTGACTGGTTCAGCCTTTCTGGG - Intronic
905649812 1:39648618-39648640 GGGTCTGCTGCAGCTTTCATGGG - Intergenic
905954095 1:41977658-41977680 TTGTATGTTGCAGCTTTTCAAGG - Intronic
907644335 1:56226804-56226826 TGCTCTGCTGCAGGTGTTCTTGG - Intergenic
908252412 1:62275391-62275413 TGGTCTTGTACTGCTTTTCTGGG + Intronic
908349598 1:63271497-63271519 TGGTCTGGGGCAAGGTTTCTGGG - Intergenic
909148193 1:71965041-71965063 GGGTCTGGGTCAGCTTTTATTGG - Intronic
916765448 1:167855712-167855734 TGGTCTGGTCCACCTTTTGAAGG - Intronic
921744050 1:218717474-218717496 TGGTCTCGTTCAGCTTTCCAAGG + Intergenic
924181741 1:241445861-241445883 CATTCTGGTGCAGCATTTCTTGG + Intergenic
1064250514 10:13703110-13703132 TTGTCTAATTCAGCTTTTCTGGG - Intronic
1066584206 10:36913928-36913950 TCGTCTGTTACAGCTTTGCTTGG + Intergenic
1067717851 10:48703598-48703620 TGCTCTGGGGCAGCTTTTCCTGG + Intronic
1068107871 10:52642542-52642564 TTCTCTGGTGAAGCTTTCCTGGG - Intergenic
1068147307 10:53088302-53088324 TGGTCTGGTCCAGCCCATCTTGG - Intergenic
1068778542 10:60894261-60894283 TGGTCTGGTGCAGCTTTTCTTGG - Intronic
1069262534 10:66415662-66415684 AGCTCTGGTGCAGTTTTGCTTGG - Intronic
1071404689 10:85318627-85318649 TGGTCTACTGCTGCTTTGCTAGG - Intergenic
1073600320 10:104840063-104840085 TGGCCAGGAGCAGCTTTTGTGGG + Intronic
1074521228 10:114226060-114226082 TGGTATCGTGCAGTTGTTCTGGG + Exonic
1077821698 11:5750399-5750421 TGCACTTTTGCAGCTTTTCTTGG - Intronic
1080381921 11:31780728-31780750 TGGACTGGCTCAGCATTTCTTGG - Intronic
1081649734 11:44815758-44815780 TGGGCAGGGGCAGCTTCTCTTGG + Intronic
1084555885 11:69875572-69875594 GGGTCTGGGGCCGCCTTTCTGGG - Intergenic
1087007867 11:93486713-93486735 AGGTCTGGTCAAGCTCTTCTCGG - Intronic
1088716829 11:112555916-112555938 TGGCCTGGGGGAACTTTTCTGGG + Intergenic
1091971584 12:4791926-4791948 TGGTTTGGGGGAGCTTTTGTGGG + Intronic
1092519324 12:9251280-9251302 TGGTCTTGTGCAGGTTTTCCAGG - Intergenic
1095110323 12:38287938-38287960 ATTTCTGGTGCAGCATTTCTAGG - Intergenic
1098250319 12:68562377-68562399 TGGACTGGTTCAGCTGCTCTAGG + Intergenic
1100328122 12:93560280-93560302 TTGTCTTGTGCAGGTTTTCAAGG - Intergenic
1111030679 13:82592919-82592941 AGCTGTGGTGCAGGTTTTCTGGG - Intergenic
1112206655 13:97330393-97330415 GGGACTGGTGCAGCTTCTGTGGG - Intronic
1113104756 13:106759990-106760012 TGGTCTTTTGTAGCCTTTCTAGG + Intergenic
1114518238 14:23315246-23315268 TGGTCTGGTCCTGCTTACCTTGG - Intronic
1115086833 14:29525836-29525858 TGGTCTCCAGCAGCTTGTCTTGG + Intergenic
1115443737 14:33465616-33465638 TGGTCACATGTAGCTTTTCTAGG - Intronic
1115823097 14:37233745-37233767 CTCTCTGGTGAAGCTTTTCTAGG + Intronic
1115927571 14:38452833-38452855 TTGTCTTGTGCAGGTTTTCAAGG - Intergenic
1117199654 14:53375756-53375778 TGGTCTGGTGCAACCATTCACGG - Intergenic
1117375903 14:55118026-55118048 TGGTCTGAGGCAACTCTTCTAGG + Intergenic
1118717133 14:68568442-68568464 TGGTCTGGTACAGGTTTGCTTGG - Intronic
1119696525 14:76717846-76717868 TGGGCTGGGGCAGGTTTTATAGG - Intergenic
1119846362 14:77833188-77833210 TGTTCAGGGGTAGCTTTTCTTGG + Intronic
1121512934 14:94526099-94526121 TTGTCTTGTGCAGGTTTTCAAGG - Intergenic
1122423762 14:101593613-101593635 TGGGCTGGTGCAGTATTACTAGG - Intergenic
1125450366 15:39801212-39801234 TTGTCTGGATCAGCTCTTCTGGG + Exonic
1125594906 15:40878587-40878609 TGGGCTGGGGCAGCTTCCCTGGG - Intergenic
1127858167 15:62969616-62969638 TGGTCTGGTGTAGTTTTGTTTGG + Intergenic
1129287235 15:74535459-74535481 TGGTCTGGGCCAGCTTAGCTGGG + Intergenic
1130997351 15:88911368-88911390 GGGTCTGGGGCAGCCCTTCTGGG - Intronic
1131949408 15:97664831-97664853 TAGTCTGCTGAAGCTGTTCTTGG + Intergenic
1133913415 16:10086566-10086588 TGGTATGGTGCAGCTTCTCCTGG - Intronic
1134286511 16:12866762-12866784 CGGACTAATGCAGCTTTTCTTGG + Intergenic
1135634453 16:24062205-24062227 TGATCTGGGCCAGCTTGTCTGGG + Intronic
1135911121 16:26561856-26561878 TTGTCTTGTGCAGGTTTTCAAGG - Intergenic
1136624062 16:31450925-31450947 TGGTGTGGTGCAGCCATGCTGGG + Intergenic
1138344297 16:56310807-56310829 TAGTCTGGGGCAGGTGTTCTTGG + Intronic
1138984563 16:62312288-62312310 TCATGTGTTGCAGCTTTTCTAGG + Intergenic
1139664123 16:68444322-68444344 TGCACTAATGCAGCTTTTCTCGG - Intronic
1140721329 16:77774999-77775021 TGGTTTGGTGCAGTTCCTCTGGG + Intergenic
1141493444 16:84390406-84390428 TTGTTGGGTGCAGCTTCTCTTGG + Intronic
1142379690 16:89724231-89724253 TGGGCTGGTGCAGCTGCTCCTGG + Intronic
1142772346 17:2107601-2107623 TGGGCTGGGGCAGCTCCTCTGGG + Intronic
1145217213 17:21061339-21061361 TGGGCTGCTGCAGCTGTGCTTGG + Intergenic
1145909230 17:28533059-28533081 GGACCTGGTGCAGCCTTTCTTGG - Intronic
1146751625 17:35386961-35386983 TTGTCTTGTGCAAGTTTTCTAGG + Intergenic
1149450303 17:56744937-56744959 TGGGCTGGTGCAGCATGTCCAGG + Intergenic
1150191375 17:63244100-63244122 TTCTCTGGTGGAGCTTTCCTAGG + Intronic
1153094691 18:1387352-1387374 TGGTCTTGTGCTGATTTTCAAGG - Intergenic
1154133994 18:11760382-11760404 AGGTCTGGTGCATGTTTTATGGG + Intronic
1156551076 18:38017570-38017592 TTGTCTTGTGCAGGTTTTCAAGG + Intergenic
1157806253 18:50659917-50659939 TGGTGTGGTGCAGCTTCTCAGGG - Intronic
1160933636 19:1582703-1582725 GTGTCTGGGGCAGCTCTTCTGGG - Exonic
1161580232 19:5076908-5076930 TGGTCTGGTGGATTTTGTCTGGG + Intronic
1165506320 19:36233084-36233106 TGGCCAGGAGCTGCTTTTCTTGG - Intronic
1166648280 19:44549159-44549181 GGGGCTGGTGCAGCTTCTCTGGG + Intergenic
925358737 2:3262493-3262515 TGGGCTGGTCCAGCCTTCCTAGG - Intronic
927437153 2:23076535-23076557 TTGTCTGTTGCAGCTTAGCTTGG - Intergenic
928100667 2:28435706-28435728 GGTGCTGGTGGAGCTTTTCTGGG + Intergenic
928257346 2:29734245-29734267 TGGTCTGCAGCACCTTTTCTTGG - Intronic
929218264 2:39437727-39437749 TGGAGTGCTGCAGCCTTTCTGGG + Intergenic
930037123 2:47093407-47093429 TGTTCCTGTGCAGATTTTCTTGG - Intronic
931422014 2:62136753-62136775 GGGTCAGGTACATCTTTTCTAGG - Intronic
932380055 2:71274302-71274324 TTGTCTTGTGCTGCTTTTCAAGG - Intergenic
933765886 2:85709162-85709184 TGCAGTGGTGCAGCTTTTTTTGG + Intergenic
933936910 2:87213459-87213481 TTGGCTGGGGAAGCTTTTCTTGG + Intergenic
935406394 2:102714736-102714758 TGATGTGTAGCAGCTTTTCTTGG - Intergenic
936356233 2:111752366-111752388 TTGGCTGGGGAAGCTTTTCTTGG - Intergenic
937126660 2:119478922-119478944 TTGTCTGATGCTGCTTTTCTTGG - Intronic
940355297 2:152735033-152735055 TCTCCTGTTGCAGCTTTTCTTGG + Exonic
940438671 2:153686707-153686729 TGGTCTTGTGCAGGTTTTCAAGG + Intergenic
943113379 2:183636195-183636217 TGCACTGCTGCAGCTTTTCCAGG - Intergenic
943501336 2:188693265-188693287 TGGGTTGGTGCATCTTTGCTGGG + Intergenic
944998164 2:205318350-205318372 TGGTCTGGTATAGTGTTTCTGGG - Intronic
945775767 2:214104362-214104384 TGGTCTGATTCAGCTTTTGTTGG + Intronic
947401712 2:229736941-229736963 GGCTGTGGTGCAGTTTTTCTGGG - Intergenic
947915891 2:233831298-233831320 TGGCTTGGTGAGGCTTTTCTGGG + Intronic
948881777 2:240861875-240861897 TGGTCTGGAACAGCTTTGCTAGG - Intergenic
1169033902 20:2434148-2434170 CTCTCTGGTGAAGCTTTTCTGGG - Intergenic
1170984006 20:21241863-21241885 TTTTCTGCTTCAGCTTTTCTGGG + Intronic
1172787060 20:37475393-37475415 TGGGCTAGTGAAGCGTTTCTAGG - Intergenic
1172877558 20:38175052-38175074 TGGTCTGGGGCAGGTTATTTAGG - Intergenic
1177280343 21:18973872-18973894 TTGTCTTGTGCTGCTTTTCAAGG - Intergenic
1177526748 21:22302773-22302795 TTGTCTTGTGCTGGTTTTCTAGG - Intergenic
1179618012 21:42594075-42594097 TGGTTTGTTGCAGCCTTTTTTGG - Intergenic
1180996518 22:19968470-19968492 TGGTTTGGGGCAGGTTCTCTGGG + Intronic
1183083608 22:35473057-35473079 TGGTCTGGGGCAGTTGTCCTAGG - Intergenic
1183705788 22:39474234-39474256 TGGGCAGATGCAGCTTTCCTGGG + Intronic
1185408066 22:50667247-50667269 TGGTCTGATTCTGCTTTTCGTGG - Intergenic
950430025 3:12945227-12945249 TGGCCTGGGGCAGACTTTCTGGG + Intronic
952221125 3:31325310-31325332 TGGTCTGGAGGAACTTGTCTGGG - Intergenic
952267814 3:31803199-31803221 TGGCCTGGTAGAGCTTTGCTTGG - Intronic
952518142 3:34126624-34126646 TTGTCTTGTGCTGCTTTTCAAGG - Intergenic
953080598 3:39613414-39613436 TCTCCTGGGGCAGCTTTTCTGGG - Intergenic
954034546 3:47844164-47844186 TGGTCAGGTGCACCATTTCATGG + Intronic
954632336 3:52054420-52054442 TGGTCTTGTGCAGCCCATCTGGG - Intronic
956923619 3:73957891-73957913 CTCTCTGGTGAAGCTTTTCTGGG - Intergenic
957495630 3:80987877-80987899 TTGTCTGGTGCAAGTTTTCAAGG - Intergenic
959368251 3:105490825-105490847 TGGCATTGAGCAGCTTTTCTCGG + Intronic
959439065 3:106354322-106354344 TTGTTTTGTGCTGCTTTTCTGGG + Intergenic
960119736 3:113935335-113935357 TTGTCAGATGCAGCTTTCCTGGG + Intronic
960305032 3:116050584-116050606 TGGTTTGCTGGTGCTTTTCTAGG - Intronic
960702336 3:120450899-120450921 TGGTCTGGTCCAGGTCTCCTGGG + Exonic
964627892 3:158776698-158776720 TCCTCTTGTGCAGCTTCTCTCGG - Intronic
965182234 3:165418853-165418875 TGGTCTTGTGCTGGTTTTCAAGG - Intergenic
965942244 3:174199165-174199187 TTTTATGGAGCAGCTTTTCTGGG + Intronic
965970292 3:174546321-174546343 TATTCTGGTTCAGCCTTTCTAGG + Intronic
968222138 3:196947382-196947404 TTGTCTGGTGAAGCTTTTCAGGG + Exonic
968359609 3:198137936-198137958 TCGTCTCGTGCAGCTGGTCTAGG + Intergenic
973188826 4:47363765-47363787 TGGTCTGATGGAGCTTAACTTGG - Intronic
974090259 4:57303280-57303302 CCGTCTGTTGCAGCTTTGCTTGG + Intergenic
974316041 4:60282237-60282259 TGGTCAGGTGTGGCTTTCCTGGG + Intergenic
974387554 4:61222195-61222217 TGGTCTGGTCAAGATTTTTTTGG + Intronic
974532302 4:63124486-63124508 TGGACTGGTGCACCATTTCTTGG + Intergenic
975322734 4:73026683-73026705 TGGACTAGTGCAGATTATCTGGG + Intergenic
975360903 4:73470631-73470653 TTGTCTTGTGCAGGTTTTCAGGG + Intergenic
976693409 4:87893014-87893036 TGCTCTGCTGGAGCATTTCTCGG - Intergenic
977752407 4:100625225-100625247 TTGTCTTGTGCTGGTTTTCTAGG - Intronic
979563869 4:122132162-122132184 TTCTCTGGTGAAGCTTTCCTGGG - Intergenic
979662789 4:123277542-123277564 TGGTCTTGTGCTGTTTTTCAAGG + Intronic
982218231 4:153101261-153101283 TTGTCTTGTGCAGGTTTTCAAGG - Intergenic
982531504 4:156550315-156550337 TGTTCTGCTGCCTCTTTTCTAGG - Intergenic
983379142 4:166968858-166968880 TTGAGTGTTGCAGCTTTTCTAGG - Intronic
985340387 4:188946385-188946407 TTGTCTTGTGCAGGTTTTCAGGG - Intergenic
985610338 5:884478-884500 TGGTCTGGTGCTGCTGGGCTGGG + Intronic
986316192 5:6588785-6588807 TGGCCTAGTGCCTCTTTTCTTGG + Intergenic
987270017 5:16297791-16297813 TTGTCTGGTGCTGGTTTTCAAGG - Intergenic
988336721 5:29917626-29917648 TTGTCTTGTGCTGCTTTTCAAGG - Intergenic
990473279 5:56137912-56137934 TGATGTGGTGCATCTTTTCATGG - Intronic
993751811 5:91678663-91678685 TTGTCTTGTGCTGCTTTTCAAGG + Intergenic
994726285 5:103440352-103440374 GGCTGTGGTGCAGCTTTGCTGGG + Intergenic
995346378 5:111123883-111123905 TGTTCAGGTGCAGCATATCTGGG - Exonic
996555591 5:124775842-124775864 TGGTCTGGGGCAGATTAGCTAGG + Intergenic
997620387 5:135286409-135286431 TAGATTGGTGCAGCTATTCTGGG - Intronic
998277834 5:140775482-140775504 TTGTCTTGTGCTGCTTTTCAAGG + Intergenic
1000130405 5:158291607-158291629 TGCTCTGGTGCAGCTTAAGTGGG + Intergenic
1000494112 5:161956804-161956826 TTCTCTGGTGAAGATTTTCTGGG - Intergenic
1000509971 5:162168681-162168703 TTGTCTTGTGCTGCTTTTCAAGG - Intergenic
1001435911 5:171699014-171699036 TGGTCTGGAGCCCCTTTTCATGG - Intergenic
1003528138 6:6915402-6915424 TGGTCTGGGGCTGCTTTCCCAGG - Intergenic
1004430813 6:15541110-15541132 TGGTGTGGTGCAACTATACTCGG - Intronic
1004972759 6:20930087-20930109 TGTTTTAATGCAGCTTTTCTTGG - Intronic
1005924065 6:30426802-30426824 TTGTCTGGTGCCGGTTTTCAAGG - Intergenic
1006389103 6:33748183-33748205 TGGTCTGGTTCAGCCTCTCTCGG + Intergenic
1006587037 6:35122048-35122070 AGGTCTGGCCCAGCTTTTCCGGG + Intronic
1007667443 6:43523581-43523603 TGCTCTGCTCTAGCTTTTCTTGG + Exonic
1007780571 6:44251467-44251489 TGCTCTGCTGGAGCATTTCTCGG - Exonic
1007872707 6:45059511-45059533 TTGTCTTGTGCTGGTTTTCTGGG - Intronic
1007884810 6:45215002-45215024 TGCTGTCGTGCAGCTTTCCTGGG - Intronic
1008384477 6:50872779-50872801 TGGTCTGATCCACCTCTTCTAGG + Intergenic
1010468687 6:76199664-76199686 TTGTCTTGTGCAGGTTTTCAAGG - Intergenic
1010520216 6:76823339-76823361 TTGTCTTGTGCTGGTTTTCTAGG + Intergenic
1011021407 6:82817324-82817346 TTGTCTGGTGCAGCATTTTCAGG + Intergenic
1011366946 6:86593063-86593085 GGGTAGGCTGCAGCTTTTCTTGG - Intergenic
1013862569 6:114653248-114653270 TGATCTCTTGGAGCTTTTCTGGG + Intergenic
1014570195 6:122997846-122997868 TGTCCTGGTGCAGCGTGTCTGGG - Exonic
1015668237 6:135656362-135656384 TGGTCTGGGCAAGCATTTCTTGG - Intergenic
1019260383 7:78715-78737 TCGTCTCGTGCAGCTGGTCTAGG - Intergenic
1020607058 7:10352582-10352604 TTGTCTTGTGCAGATTTTCAAGG + Intergenic
1022007589 7:26280397-26280419 GGGTCTGGGGCAGGTTTTATGGG - Intergenic
1022108229 7:27211968-27211990 TGGTCTGGAGGAGCATTTGTGGG - Intergenic
1022183128 7:27941157-27941179 TCATTTGGTGCAGCTATTCTAGG - Intronic
1022943785 7:35262256-35262278 CGGCCAGCTGCAGCTTTTCTGGG + Intergenic
1023864741 7:44233359-44233381 TGGCCTGGTGCAGCCTACCTAGG - Intronic
1024426912 7:49236491-49236513 TGGTCCTGTGCTGCTTTTCAAGG + Intergenic
1024798084 7:53042431-53042453 CTCTCTGGTGAAGCTTTTCTGGG - Intergenic
1027145116 7:75688678-75688700 TGGTTTGGTGCAGCTGTCCCGGG - Intronic
1029659539 7:101950620-101950642 TTGTCTGTGGCTGCTTTTCTGGG + Intronic
1030134089 7:106229727-106229749 TTGTCTTGTGCAGGTTTTCAAGG + Intergenic
1033706391 7:143889811-143889833 CTGTCTGGTGAAGCTTTCCTGGG - Intronic
1033780228 7:144659813-144659835 TGGGCAGTTGGAGCTTTTCTGGG - Intronic
1034881341 7:154764934-154764956 TGGTTTGGTGCTGCTTTCTTAGG - Intronic
1038391674 8:27207670-27207692 TGAGATTGTGCAGCTTTTCTTGG + Intergenic
1040040974 8:42916642-42916664 CTGTCTGGTGCAGCTTTATTAGG - Intronic
1041309383 8:56499079-56499101 TTCTCTGTTGAAGCTTTTCTGGG + Intergenic
1043374623 8:79634799-79634821 TTGACAGGTGCATCTTTTCTTGG - Intronic
1046005304 8:108473998-108474020 TGGTCTAGTCCAGCTTTTCTAGG - Intronic
1046450327 8:114382105-114382127 TGTACATGTGCAGCTTTTCTGGG + Intergenic
1047770473 8:128026603-128026625 TGCCCTGGTGCAGCTGATCTCGG - Intergenic
1048648390 8:136447885-136447907 TTGTGTGGTGCAGCTTTAGTAGG + Intergenic
1049773272 8:144393458-144393480 TGGTGTGGTGCCGATCTTCTTGG + Exonic
1050075496 9:1858285-1858307 AGCTGTGGTGCAGCTTTGCTGGG - Intergenic
1051401913 9:16692567-16692589 TGCTGTGGTGCTGCTTTTGTGGG - Intronic
1054973167 9:71112900-71112922 AGGTCTGGTGCAGGTTTTCCAGG + Intronic
1056003862 9:82246489-82246511 TGGTTTGGTTTTGCTTTTCTAGG + Intergenic
1056066019 9:82935784-82935806 TGTTGTGGTGCAGCTCTTCCTGG - Intergenic
1056143460 9:83707266-83707288 CGGGCTGATGCCGCTTTTCTCGG - Intronic
1058372781 9:104289048-104289070 TGCTGTGCTGCAGTTTTTCTAGG - Intergenic
1058534479 9:105943195-105943217 TTGTCTTGTGCAAGTTTTCTAGG - Intergenic
1059227204 9:112682988-112683010 TGTTCTGATGTAGCTTTTATTGG + Intergenic
1060024048 9:120156170-120156192 TGGTCTTGGGCTGCTTTTCTAGG - Intergenic
1060604171 9:124899412-124899434 TGCTCTGGAGCAGCAGTTCTTGG - Exonic
1060685416 9:125606598-125606620 TTGTCTGGTGCAGTTTCTCATGG - Intronic
1061144710 9:128790884-128790906 TTGTCTGAGGGAGCTTTTCTGGG + Intronic
1062708961 9:137961433-137961455 TTGTCTTGTGCAGGTTTTCAAGG + Intronic
1062744297 9:138201666-138201688 TCGTCTTGTGCAGCTGGTCTAGG + Intergenic
1062744316 9:138201757-138201779 TCGTCTCGTGCAGCTGGTCTAGG + Intergenic
1186411293 X:9346689-9346711 TGATCTGGTGCAGAGTGTCTTGG - Intergenic
1186912999 X:14189678-14189700 TTGTCTGGTGCTGATTTTCAAGG + Intergenic
1187818550 X:23259981-23260003 TTGTCTTGTGCTGCTTTTCAAGG - Intergenic
1188544261 X:31285973-31285995 TGTTCTTGTCCAGCTGTTCTTGG - Intronic
1192226525 X:69231987-69232009 TGCTGTGGTGCAGCTTTTCCAGG + Intergenic
1193302004 X:79900414-79900436 TTGTCTTGTGCAGGTTTTCCAGG - Intergenic
1193946639 X:87744796-87744818 TGGTCTTGAGAAGCTTTTCAAGG + Intergenic
1195170041 X:102258471-102258493 GTGTCTCTTGCAGCTTTTCTTGG + Intergenic
1195188816 X:102428629-102428651 GTGTCTCTTGCAGCTTTTCTTGG - Intronic
1196132351 X:112170813-112170835 TTGTCTTGTGCTGCTTTTCAAGG + Intergenic
1196564945 X:117193968-117193990 TGGTTTGCTCTAGCTTTTCTAGG - Intergenic
1197718755 X:129730192-129730214 TGATTTGCTACAGCTTTTCTTGG + Intergenic
1198881978 X:141291660-141291682 TGCTCTGGTGCTGTTTCTCTGGG - Intergenic
1201592164 Y:15627526-15627548 TGGACTCGTTCAGCTTTTCCTGG + Intergenic
1201962470 Y:19696902-19696924 TGGTCTGGGAAAGCATTTCTTGG + Intergenic
1202050537 Y:20775989-20776011 TGGTCTAGTGCTGCTTTTCTTGG + Intronic