ID: 1068778707

View in Genome Browser
Species Human (GRCh38)
Location 10:60896391-60896413
Sequence CAGCTGAAACAGGACCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 242}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068778707_1068778710 4 Left 1068778707 10:60896391-60896413 CCTCAGGGGTCCTGTTTCAGCTG 0: 1
1: 0
2: 3
3: 24
4: 242
Right 1068778710 10:60896418-60896440 AGAATCAAATAGGATTTAAATGG No data
1068778707_1068778713 24 Left 1068778707 10:60896391-60896413 CCTCAGGGGTCCTGTTTCAGCTG 0: 1
1: 0
2: 3
3: 24
4: 242
Right 1068778713 10:60896438-60896460 TGGAGTCCTACAGATATTTGGGG No data
1068778707_1068778709 -6 Left 1068778707 10:60896391-60896413 CCTCAGGGGTCCTGTTTCAGCTG 0: 1
1: 0
2: 3
3: 24
4: 242
Right 1068778709 10:60896408-60896430 CAGCTGTAAAAGAATCAAATAGG No data
1068778707_1068778712 23 Left 1068778707 10:60896391-60896413 CCTCAGGGGTCCTGTTTCAGCTG 0: 1
1: 0
2: 3
3: 24
4: 242
Right 1068778712 10:60896437-60896459 ATGGAGTCCTACAGATATTTGGG No data
1068778707_1068778711 22 Left 1068778707 10:60896391-60896413 CCTCAGGGGTCCTGTTTCAGCTG 0: 1
1: 0
2: 3
3: 24
4: 242
Right 1068778711 10:60896436-60896458 AATGGAGTCCTACAGATATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068778707 Original CRISPR CAGCTGAAACAGGACCCCTG AGG (reversed) Intronic
900338992 1:2178954-2178976 CAGCTGAACCAGCACCACTCAGG + Intronic
900494834 1:2971718-2971740 CTGCTGACACTGGCCCCCTGGGG + Intergenic
900657477 1:3766709-3766731 CAGCTGAGCCAGGACCCCTTCGG + Intronic
900972006 1:5996935-5996957 CTGGTGACTCAGGACCCCTGCGG - Intronic
900972504 1:5999302-5999324 AAGCTGCACCAGGACCCCTGAGG - Intronic
901859416 1:12064450-12064472 CAGCTGACCCAGGACCCCGGTGG + Intronic
902268108 1:15283258-15283280 CAGCTAAAACAGGGCCGCAGTGG - Intronic
902561734 1:17281805-17281827 CTGCTGAATCAGGACCGCTGGGG - Intronic
903825813 1:26145153-26145175 CAGGTGAAACAGCAGCTCTGAGG + Intergenic
904827047 1:33280538-33280560 GGGCTGAAACAGGACCCTTAGGG + Intronic
907399129 1:54213666-54213688 CTGCTGAATCAGAAACCCTGGGG + Intronic
910859803 1:91732375-91732397 CAACTGAATCAGGAACTCTGGGG - Intronic
913269808 1:117082017-117082039 CAGCTAAAAAAGGACACCTTTGG + Intronic
914382542 1:147130603-147130625 CAGCAGAGACAGGAGCCCTTTGG - Intergenic
915940502 1:160115658-160115680 TTGTTGAAACAGGATCCCTGAGG - Intergenic
916261439 1:162846385-162846407 AGGCTGAGACAGGACCCCAGCGG - Intronic
917050788 1:170920388-170920410 GAGCTGAAACTGGGCCCCTTTGG - Intergenic
917496886 1:175548597-175548619 CAGCAGAAAGAGGGGCCCTGAGG - Intronic
918246103 1:182660825-182660847 CTACTGAATCAGGATCCCTGGGG - Intronic
918334068 1:183489995-183490017 CAGCTGAATCAGAACCTCTTGGG + Intronic
920606784 1:207396602-207396624 TAGCTAAAACAGGACCCAGGTGG - Intergenic
924271536 1:242338358-242338380 CAGCTGAAACAGGTTGTCTGTGG + Intronic
1065191381 10:23212377-23212399 CAGCTGAAACAAGAGACGTGTGG - Intronic
1065963656 10:30753968-30753990 CCTCTGAAACAGGAGCCCCGGGG - Intergenic
1066713132 10:38257771-38257793 CAGCTGAAACAGGTTGTCTGTGG - Intergenic
1066782082 10:38962129-38962151 CAGCTGACCAAGGACCACTGTGG - Intergenic
1066955032 10:42158496-42158518 CAGCTGACAAAGGACCACTGTGG + Intergenic
1067179653 10:43974849-43974871 CCACTGAAAAAGGACCACTGGGG - Intergenic
1067858473 10:49819282-49819304 CAGCTCAAACAGGACGTCTCTGG + Intronic
1068000322 10:51325834-51325856 GAGCTGAGACTGGGCCCCTGAGG - Intronic
1068265378 10:54641859-54641881 AAGCTGGAACAGGACCAGTGGGG - Intronic
1068778707 10:60896391-60896413 CAGCTGAAACAGGACCCCTGAGG - Intronic
1069417651 10:68215161-68215183 CAACTGAATCAGTAGCCCTGGGG + Intergenic
1070597291 10:77841449-77841471 CTGGTGAAAAAGGGCCCCTGAGG + Intronic
1071012019 10:80950759-80950781 AAGCTGAACCAAGACCCCTAAGG + Intergenic
1071198336 10:83187775-83187797 TAGCTGGAACAGGACCTCTTGGG - Intergenic
1073208858 10:101782683-101782705 CAGGTGAACCGGGACCTCTGAGG - Intronic
1073327504 10:102651133-102651155 CAGCAGAGACAGGAGCCCAGTGG + Intronic
1074052414 10:109892217-109892239 AAGGTGAAACAGCTCCCCTGGGG - Intronic
1075561880 10:123474018-123474040 CAGCTCTAACAAGACCCCAGGGG - Intergenic
1076480755 10:130783800-130783822 CAGCAGACTCAGGACCTCTGAGG + Intergenic
1078612136 11:12830064-12830086 CATCAGACAAAGGACCCCTGGGG + Intronic
1079488936 11:20966120-20966142 CCGCTGTAACAGAACACCTGAGG + Intronic
1082210805 11:49498780-49498802 GAGCTGAGACAGGGCCCCTTTGG - Intergenic
1083333615 11:61910674-61910696 CAGCTTAAACTGGAGGCCTGTGG + Intronic
1083608878 11:63995695-63995717 CAGCTGGAACAGATCCTCTGAGG + Intronic
1085271649 11:75273390-75273412 CAGCTGAAGCACCACCTCTGCGG - Intronic
1086638834 11:89126009-89126031 GAGCTGAGACAGGGCCCCTTTGG + Intergenic
1086962164 11:92989536-92989558 CAGCTGAGAGAGGACCCCTGAGG + Intergenic
1087715606 11:101605300-101605322 AAGCTGAAACTGGATCCCAGAGG + Intronic
1088573050 11:111241829-111241851 CAGGTGAGACAGGATCCATGAGG - Intergenic
1088744285 11:112792531-112792553 CAGCTGAGAGAGGCCCACTGGGG + Intergenic
1090232673 11:125119859-125119881 CTGCTGATACAGGAACCCTGTGG - Intergenic
1093538231 12:20248229-20248251 GAGCTGACAGAGGAGCCCTGGGG + Intergenic
1097083987 12:56454159-56454181 CAGGTGAATCAGCTCCCCTGGGG - Intronic
1100316420 12:93448891-93448913 CAGTGGAAACAGGACTCCAGAGG + Intergenic
1100329933 12:93572635-93572657 CAGTCCAAACTGGACCCCTGCGG - Intronic
1103019095 12:117519414-117519436 CCGCTGAATCAGAACCTCTGCGG - Intronic
1103140293 12:118542183-118542205 CAGCTGAAACAGAAGGACTGGGG + Intergenic
1104034554 12:125089347-125089369 CAGCTGACTAGGGACCCCTGGGG + Intronic
1104585780 12:130047089-130047111 CAGCTGGGACAGAACCACTGAGG + Intergenic
1104665237 12:130643069-130643091 CAGCTGAGCCAGGACCCCTGAGG - Intronic
1105255188 13:18739619-18739641 CAGCTGAAAGAGGAGGCCAGAGG - Intergenic
1110428523 13:75397021-75397043 CAACTGAAACAGGACAACTGAGG + Intronic
1110786645 13:79536465-79536487 GAGCTGTAACAGAACACCTGTGG - Intronic
1110950003 13:81474077-81474099 CAGCTGAAAATGGATCTCTGTGG - Intergenic
1112727653 13:102323025-102323047 AAGGTGAAACAGAAGCCCTGTGG + Intronic
1112816336 13:103278190-103278212 TAGCTGAAACAGGTCCCTAGTGG + Intergenic
1113777233 13:112954700-112954722 CAGCTGCTCCAGGACCTCTGGGG + Intronic
1113792321 13:113035513-113035535 GAGGGGAGACAGGACCCCTGAGG - Intronic
1114576131 14:23715365-23715387 AGGCTGAAACAGAGCCCCTGAGG - Intergenic
1115263544 14:31477472-31477494 CAGCAGCAACAGGATCCCTTGGG + Intergenic
1117350611 14:54877882-54877904 CACCTGAAACAGAAGCCCTAGGG - Intronic
1118690754 14:68337646-68337668 CAGCTGAATCAGAATCCCTGGGG + Intronic
1118859319 14:69650190-69650212 CAGCTGAAACAGTGCCCTTTGGG + Intronic
1119260542 14:73235813-73235835 CAGCTGTAGCGGGGCCCCTGGGG - Intergenic
1119860386 14:77931759-77931781 CAGCAAAAGCAGGACCCCTGGGG - Intronic
1120103710 14:80471616-80471638 GAGGTGAAACAATACCCCTGGGG + Intergenic
1120745393 14:88147051-88147073 CAGCTGAAGCTGCACCCCAGAGG - Intergenic
1120838997 14:89066468-89066490 CAGCTAAATCAGAATCCCTGAGG - Intergenic
1122282058 14:100629345-100629367 GAGCTGAAGCAGAACCCCTGGGG + Intergenic
1122931767 14:104936382-104936404 GAACTGACACAGGTCCCCTGGGG - Exonic
1123394633 15:19919468-19919490 CAGCTGACAAAGGATCACTGTGG - Intergenic
1123631439 15:22262897-22262919 CAGGTGGAACAGGAGCCCTCAGG - Intergenic
1124796044 15:32780763-32780785 CTGCTGATACAGGACCCCACCGG - Intronic
1124930802 15:34117485-34117507 CAACTAAAAAAGTACCCCTGTGG - Intergenic
1126456304 15:48865801-48865823 CTGCTTGAAGAGGACCCCTGGGG - Intronic
1127361288 15:58247145-58247167 CAGGTGACAGAGGACCACTGAGG - Intronic
1127622644 15:60749050-60749072 CTTCTGAATCAGGATCCCTGGGG - Intronic
1129404736 15:75308523-75308545 CAGCTGAAACTGGAACCCAGGGG + Intergenic
1129478321 15:75802771-75802793 CAGCTGAAACTGGAACCCAGGGG + Intergenic
1129836405 15:78710092-78710114 CAGCTGAAACTGGAACCCAGGGG + Intronic
1130510778 15:84587612-84587634 CAGCTGAAACTGGAACCCAGGGG - Intergenic
1131653187 15:94424479-94424501 CTGCTGAATCAGGAACTCTGGGG + Intronic
1132085890 15:98907957-98907979 CAGCTGAATCAGAAGCTCTGGGG + Intronic
1132285387 15:100658673-100658695 CATCTAAAACAGGGCCCATGTGG - Intergenic
1132628274 16:902775-902797 CAGCAGAGACAGGAGTCCTGTGG - Intronic
1132628330 16:903101-903123 CAGCAGAGACAGGAGTCCTGTGG - Intronic
1132628360 16:903286-903308 CAGCAGAGACAGGAGTCCTGTGG - Intronic
1134793480 16:17012636-17012658 CAAAAGAAACAGGAACCCTGAGG + Intergenic
1136286820 16:29249013-29249035 CCTCTGTTACAGGACCCCTGGGG - Intergenic
1136863247 16:33715288-33715310 CAGCTGACCAAGGACCACTGTGG + Intergenic
1137063443 16:35812423-35812445 CAGCAGAAACTGCACACCTGTGG - Intergenic
1137085078 16:36110230-36110252 CAGCTGACCAAGGACCACTGTGG + Intergenic
1137443924 16:48520434-48520456 CAGCTGAATCAGAATCTCTGGGG + Intergenic
1138237396 16:55396273-55396295 CAGATGAAACTGGAGCCCCGCGG - Intronic
1140503824 16:75457227-75457249 CAGCTGCCACAGAACCACTGAGG + Intronic
1141246886 16:82316315-82316337 CAGCTGAATCAGAAACTCTGGGG - Intergenic
1141700812 16:85641204-85641226 GAGCTGAGACAGGTACCCTGAGG - Intronic
1141971571 16:87487574-87487596 CAGGTGGAACAGGAGCCCTCAGG + Intronic
1142092419 16:88221648-88221670 CCTCTGTTACAGGACCCCTGGGG - Intergenic
1203115007 16_KI270728v1_random:1481223-1481245 GAGCTGTAACAGGAGACCTGAGG + Intergenic
1203124738 16_KI270728v1_random:1563441-1563463 CAGCTGACCAAGGACCACTGTGG + Intergenic
1143410400 17:6705041-6705063 CAGGTGAATTAGGAGCCCTGAGG - Intronic
1145324092 17:21784517-21784539 CAGCTGACCAAGGACCACTGTGG + Intergenic
1145326518 17:21834279-21834301 CAGCTGACCAAGGACCACTGTGG - Intergenic
1145838432 17:27972764-27972786 CTGCTGAATCAGAACCTCTGAGG - Intergenic
1146497038 17:33331971-33331993 CAACTGAATCAGGGCCCCTGGGG + Intronic
1146533921 17:33633480-33633502 CAGCAGAAACAGGCTCCCTGTGG - Intronic
1146569382 17:33939707-33939729 CAGCTGGAACCAGACCGCTGTGG + Intronic
1146760238 17:35470596-35470618 CAGCTGATACAGGCTGCCTGAGG + Intronic
1148804114 17:50255675-50255697 CAGTTGAAATCGGCCCCCTGGGG + Intergenic
1149431093 17:56596028-56596050 CCGCTGAAACTTGACCCCCGAGG + Intergenic
1149682962 17:58518316-58518338 CTTCTGAAACAGGTCCCCAGTGG + Intergenic
1151570136 17:74921840-74921862 CAGCTGAACCATGTCCCGTGAGG - Intronic
1151757042 17:76080948-76080970 CAGCTGAAGCAGGATCCCCAGGG - Intronic
1152257588 17:79249099-79249121 CAGCTGACAAAGGACTCCTGAGG + Intronic
1203190707 17_KI270729v1_random:184907-184929 CAGCTGACGAAGGACCACTGTGG - Intergenic
1153925513 18:9831992-9832014 CAGCTGTTACTGGCCCCCTGTGG + Intronic
1153949792 18:10048417-10048439 CAACTGAATCAGAACCCCTCTGG - Intergenic
1154435832 18:14340983-14341005 CAGCTGAAAGAGGAGGCCAGAGG + Intergenic
1154516500 18:15172904-15172926 CAGCTGACCAAGGACCACTGTGG + Intergenic
1155503329 18:26508398-26508420 CTGTTCAAACAGGAGCCCTGGGG + Intronic
1157514088 18:48298646-48298668 CAACTGAGACAGGAGCCCAGGGG + Intronic
1157598404 18:48877827-48877849 GAGCTGGAACAGGACCCCAGAGG - Intergenic
1159546349 18:69843516-69843538 GATGTGAACCAGGACCCCTGAGG - Exonic
1159909496 18:74131855-74131877 GAACTGCAGCAGGACCCCTGGGG + Intronic
1159948092 18:74458216-74458238 CAGCTGTGACAGTTCCCCTGGGG - Intergenic
1160048211 18:75407246-75407268 AAGCTGAATCAGGCCCCCAGAGG - Intronic
1168687857 19:58359104-58359126 CAGCTGAGCCAGGGCCCCTCGGG + Intronic
925298967 2:2796415-2796437 CAGATGAACCAGGACCCTGGCGG + Intergenic
927226864 2:20775403-20775425 CTACTGAAACAGAAACCCTGGGG - Intronic
927498407 2:23565643-23565665 CAGCTGAAACTGCACTCCAGTGG + Intronic
930718874 2:54619765-54619787 GAGCGGACACAGGAGCCCTGGGG + Intronic
931214435 2:60228045-60228067 CAGTTGAATCAGGATCTCTGGGG + Intergenic
931922750 2:67038494-67038516 GAGCTGAAAGAAGGCCCCTGAGG - Intergenic
933984679 2:87580768-87580790 CAGCTGACATTGAACCCCTGAGG - Intergenic
934252349 2:90368559-90368581 CAGCTGACCAAGGACCACTGTGG + Intergenic
934257093 2:91434386-91434408 CAGCTGACCAAGGACCACTGTGG - Intergenic
934490165 2:94756852-94756874 CAGCTGAAAGAGGAGGCCAGGGG - Intergenic
934916245 2:98303157-98303179 CAGTTGGCCCAGGACCCCTGAGG + Intronic
935413282 2:102788232-102788254 CAGCTGAATGAGGACCCCTAAGG - Intronic
936030669 2:109067915-109067937 CAGCTGGAGCTGGAGCCCTGTGG - Intergenic
936309172 2:111370032-111370054 CAGCTGACATTGAACCCCTGAGG + Intergenic
936648961 2:114404481-114404503 CTGCTGAAAGAGAAACCCTGAGG + Intergenic
938516822 2:132017898-132017920 CAGCTGACCAAGGACCACTGTGG + Intergenic
939961301 2:148568378-148568400 GAGATGAAACAAGACCACTGTGG - Intergenic
941494532 2:166183308-166183330 AATCTGAATCAGAACCCCTGGGG + Intergenic
942249890 2:174038550-174038572 GAGCAGAAAGAGGACCACTGTGG + Intergenic
947555743 2:231091798-231091820 GAGGTGAAACAACACCCCTGGGG - Intronic
948195552 2:236093181-236093203 CAACTGAAGCTGCACCCCTGGGG + Intronic
1169338053 20:4773650-4773672 CTGCTGAATCAGGAACTCTGGGG + Intergenic
1169982775 20:11405284-11405306 CTGCTGAATCAGAATCCCTGTGG + Intergenic
1170592997 20:17785405-17785427 CAGCTGATACATAACCCCAGAGG + Intergenic
1171880023 20:30611592-30611614 CAGCTGAAAGGGGACGCCAGAGG - Intergenic
1172182797 20:33013873-33013895 GAGCTCCATCAGGACCCCTGTGG + Exonic
1173026192 20:39309715-39309737 CATGTGAAACAGATCCCCTGGGG + Intergenic
1173446311 20:43122093-43122115 CTACTGAATCAGGAACCCTGAGG - Intronic
1174925907 20:54759566-54759588 GAGCTGAAAAAGATCCCCTGTGG - Intergenic
1176841202 21:13844651-13844673 CAGCTGAAAGAGGAGGCCAGAGG - Intergenic
1177423275 21:20890031-20890053 CAGCAATAATAGGACCCCTGTGG - Intergenic
1180745191 22:18083678-18083700 CAGCAGAAACAGGAACACTCAGG + Exonic
1181498008 22:23298959-23298981 CTGCTGCAACAGACCCCCTGGGG + Intronic
1181983516 22:26783140-26783162 CATCTGAAAGGAGACCCCTGAGG + Intergenic
1183693259 22:39403435-39403457 CAGCTGCACCAGCACCCCTGAGG - Intronic
1184889274 22:47369556-47369578 CAGCAGAACCAGGGCCCCAGCGG + Intergenic
1185043778 22:48518707-48518729 CAGAGGAAACAGGTCCCCTAAGG + Intronic
1185323009 22:50210486-50210508 CTGGTGAGACAGGACCCCTGTGG + Intronic
949673642 3:6427655-6427677 CATATGAAGCAGGACCCCTTTGG - Intergenic
951111730 3:18811961-18811983 CACCTGAAACAAGAACCCTCAGG - Intergenic
951764822 3:26185985-26186007 AACCTGAAACAGGTGCCCTGTGG - Intergenic
951813208 3:26724277-26724299 GAGCTCAAAAAGGACCTCTGAGG + Intergenic
960299283 3:115982524-115982546 CAGCTGAAGTAGGACCCAAGAGG + Intronic
961361575 3:126371322-126371344 CAGCTCCAGCAGGACCTCTGTGG - Intergenic
962282048 3:134059473-134059495 CAGCCCATATAGGACCCCTGTGG + Intergenic
962628379 3:137250025-137250047 GAGCTGAGACTGGACCCCTCAGG - Intergenic
964461918 3:156941512-156941534 CAGCAGAAACAGCAACCATGTGG - Intronic
966287984 3:178320375-178320397 TAGCTGAAAAAGTAACCCTGTGG + Intergenic
969189047 4:5502250-5502272 CAGCTGCAACAGAGACCCTGTGG + Intergenic
972730199 4:41787513-41787535 CGGCTGGAACAGGTCACCTGAGG + Intergenic
973840944 4:54859988-54860010 CAGCTTACACAGAAGCCCTGTGG + Intergenic
976876772 4:89862775-89862797 CAGCCTGAACAGGACCCCTGTGG + Intergenic
984865852 4:184280009-184280031 CAGCTGAAAGATGAGCCCAGAGG - Intergenic
985019672 4:185674246-185674268 CAGCTGAGACTGGACAGCTGTGG - Intronic
985560030 5:580573-580595 CAGCTGAAACTTGAACACTGAGG - Intergenic
985570781 5:643667-643689 CAGGTGAGACGGGATCCCTGGGG + Intronic
985937076 5:3105797-3105819 GGGCTTACACAGGACCCCTGCGG - Intergenic
986290874 5:6397781-6397803 CAGGAGAAGCAGGACACCTGAGG - Intergenic
990981271 5:61604514-61604536 CTGCTGAATCAGAATCCCTGGGG + Intergenic
991926069 5:71706184-71706206 CAATTGAATCAGTACCCCTGAGG + Intergenic
992481576 5:77157018-77157040 CTGCTGAAGCTGGACCCCAGTGG - Intergenic
992981939 5:82184498-82184520 GACCTGAAACAGAGCCCCTGGGG - Intronic
993252479 5:85547499-85547521 AAGATGAAAAATGACCCCTGAGG + Intergenic
995857080 5:116604827-116604849 CACCATAAACAGGACCCCAGTGG - Intergenic
997393110 5:133532970-133532992 CAGCTGAGACAGGGTCTCTGGGG - Intronic
998218258 5:140253910-140253932 CAACTGAACCAGAAACCCTGGGG + Intronic
998348297 5:141484034-141484056 CAGCTCCAAGAGGTCCCCTGGGG + Intronic
999507712 5:152215400-152215422 CAGCAGCATCAGGAGCCCTGAGG - Intergenic
1000663775 5:163969549-163969571 CAGCAGAAACTGAACCCCTCTGG - Intergenic
1001071315 5:168587572-168587594 CAGCTGAAACAGGGCCTTTAGGG - Intergenic
1001102891 5:168828749-168828771 CTACTGAATCAGGAACCCTGGGG + Intronic
1001187930 5:169595014-169595036 CAGCTGAAGTAGGAACCCTAGGG - Intronic
1001296940 5:170504836-170504858 CAGCGGCAACTGGACCCCTCTGG + Intronic
1001844473 5:174909898-174909920 CAGCTGAAACTGGAACCCAGGGG - Intergenic
1002431605 5:179207418-179207440 CAGCTGGGCCAGGTCCCCTGAGG - Intronic
1002826445 6:778242-778264 CCGCTGAATTAGGACCTCTGAGG + Intergenic
1006025883 6:31146479-31146501 CAGCTTAAACAGGCCCCAGGAGG + Intronic
1009781756 6:68280295-68280317 CAGCTGACAAAAGAGCCCTGCGG + Intergenic
1012453714 6:99381451-99381473 GAACTGAAAAAGGACCCATGTGG - Intronic
1013430255 6:110049164-110049186 GATCTGAAACAGGACCTCTGGGG - Intergenic
1014049063 6:116930586-116930608 CAGCTGAGAAAGGAATCCTGAGG + Intronic
1017900445 6:158714856-158714878 CAGCTGACACAGGGCTCATGAGG - Intronic
1018960103 6:168441673-168441695 CAGCCGCAGCAGGACCCCGGCGG - Intronic
1019961795 7:4466675-4466697 CTGCTGAATCAGAAACCCTGAGG + Intergenic
1020194858 7:6029533-6029555 CAGCTGCATCAGAACTCCTGCGG + Intronic
1020656803 7:10937744-10937766 CAGCTGAATCAGAATCTCTGGGG + Intronic
1022178062 7:27891340-27891362 TAGCTGAAACAGAGACCCTGTGG + Intronic
1022389328 7:29929519-29929541 CTTCTGACACAGGACCCCTTGGG + Intronic
1023865182 7:44235064-44235086 CAGCTGAGCCAGCACCCCAGAGG + Intronic
1024807233 7:53157334-53157356 CAGCTGACCAAGGACCACTGTGG + Intergenic
1025319456 7:58078859-58078881 CAGCTGACCAAGGACCACTGTGG - Intergenic
1025554259 7:62284616-62284638 CAGCTGACCAAGGACCACTGTGG + Intergenic
1025560522 7:62368658-62368680 CAGCTGACCAAGGACCACTGTGG - Intergenic
1025988569 7:66477022-66477044 CAGCTGAATCAGAAACTCTGGGG - Intergenic
1028920837 7:96308343-96308365 CAGCAGATACCTGACCCCTGTGG + Intronic
1030043939 7:105477739-105477761 GAGCTGGAACAGGACCAATGGGG - Intronic
1031273329 7:119683972-119683994 CAGCAGAAACATCACCACTGAGG - Intergenic
1031320443 7:120320060-120320082 AAGATGAAACAGGACCACTCAGG - Intronic
1031576500 7:123421356-123421378 CAACCCAAACAGCACCCCTGGGG - Intergenic
1031893538 7:127322876-127322898 CAGCTGAGACAGGACCACTGTGG + Intergenic
1031983381 7:128145221-128145243 CAGCTAAACCAGGACCCAGGTGG - Intergenic
1032417045 7:131743799-131743821 CTGCTGAATCAGGATCTCTGGGG - Intergenic
1033265609 7:139884150-139884172 CAGCTGAAACCGAACTCCAGTGG + Intronic
1035773814 8:2171786-2171808 TAGCTAAAACACGGCCCCTGGGG - Intergenic
1042612258 8:70612478-70612500 CAGCTGAAAGAAGACCAATGTGG - Intronic
1043180427 8:77081935-77081957 CAACTGTAACAGGATCCTTGGGG + Intergenic
1044527742 8:93270909-93270931 CACCTGAACCAGGACCCAGGAGG - Intergenic
1045030484 8:98130504-98130526 CAGCTCAAACAGCACTTCTGGGG - Intronic
1048653756 8:136512033-136512055 CAGCAGCAATAGCACCCCTGTGG + Intergenic
1049518304 8:143073702-143073724 CTCCTCAAACAGGAGCCCTGGGG - Intergenic
1050998975 9:12256798-12256820 CAGCTGTACCCAGACCCCTGAGG - Intergenic
1057104654 9:92401540-92401562 CAGTTCAGACAAGACCCCTGAGG - Intronic
1057373949 9:94501179-94501201 CAGCAGAAACAGGAACTTTGTGG - Intergenic
1059132968 9:111773995-111774017 CCGGTGACACAGGACACCTGAGG + Intronic
1060468070 9:123925324-123925346 CAGCTGAAACATGATCCCCTTGG + Intronic
1060552809 9:124493621-124493643 CTGCTCAAACAGGAGCCATGAGG + Intronic
1060787963 9:126465372-126465394 CAATTGAATCAGAACCCCTGGGG + Intronic
1061001752 9:127906538-127906560 CAGCTGAAGCCGGACAACTGTGG - Intergenic
1061400354 9:130365038-130365060 CAGCTGAGTCAGGGGCCCTGAGG - Intronic
1062145044 9:134984461-134984483 CAGCAGCAGCAGGAGCCCTGTGG - Intergenic
1062254536 9:135614796-135614818 CAGCAGCACCAGGACCCCAGGGG - Intergenic
1187098681 X:16170583-16170605 CAGCTGAAGCAGGAGAGCTGGGG - Exonic
1192150070 X:68706630-68706652 CAAATGAAACAGTGCCCCTGAGG + Intronic
1195244255 X:102981284-102981306 CTACTGAAACAGGAACTCTGGGG - Intergenic
1199618264 X:149676397-149676419 AAGGTGAAACAGCACCTCTGGGG - Intergenic
1199624378 X:149726852-149726874 AAGGTGAAACAGCACCTCTGGGG + Intergenic
1200217698 X:154375218-154375240 CAGCAGAAACAGGATCGCTCAGG + Intergenic
1202053541 Y:20805568-20805590 AAGGTGAAACAGCACCTCTGGGG + Intergenic
1202296487 Y:23363729-23363751 CAGCTGCAACAGAAACCATGTGG - Intergenic
1202574320 Y:26306868-26306890 CAGCTGCAACAGAAACCATGTGG + Intergenic