ID: 1068778708

View in Genome Browser
Species Human (GRCh38)
Location 10:60896401-60896423
Sequence GATTCTTTTACAGCTGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 191}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068778708_1068778712 13 Left 1068778708 10:60896401-60896423 CCTGTTTCAGCTGTAAAAGAATC 0: 1
1: 0
2: 0
3: 10
4: 191
Right 1068778712 10:60896437-60896459 ATGGAGTCCTACAGATATTTGGG No data
1068778708_1068778710 -6 Left 1068778708 10:60896401-60896423 CCTGTTTCAGCTGTAAAAGAATC 0: 1
1: 0
2: 0
3: 10
4: 191
Right 1068778710 10:60896418-60896440 AGAATCAAATAGGATTTAAATGG No data
1068778708_1068778711 12 Left 1068778708 10:60896401-60896423 CCTGTTTCAGCTGTAAAAGAATC 0: 1
1: 0
2: 0
3: 10
4: 191
Right 1068778711 10:60896436-60896458 AATGGAGTCCTACAGATATTTGG No data
1068778708_1068778713 14 Left 1068778708 10:60896401-60896423 CCTGTTTCAGCTGTAAAAGAATC 0: 1
1: 0
2: 0
3: 10
4: 191
Right 1068778713 10:60896438-60896460 TGGAGTCCTACAGATATTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068778708 Original CRISPR GATTCTTTTACAGCTGAAAC AGG (reversed) Intronic
903241054 1:21982952-21982974 GATTCTGATACAGCTGAACTGGG + Intronic
903489763 1:23719389-23719411 AATTTTTTTACAGCAGAAATAGG - Intergenic
904405589 1:30286189-30286211 GATGGATTTACAGCTGACACAGG - Intergenic
904458576 1:30662153-30662175 GATGGATTTACAGCTGACACAGG - Intergenic
905605197 1:39291897-39291919 TTTTCTTTTTCAGATGAAACTGG + Exonic
907754011 1:57292188-57292210 TATTCTTTTTGAACTGAAACTGG - Intronic
909159849 1:72132770-72132792 GATTATTTTAAAACTGAAAATGG + Intronic
909812362 1:79946230-79946252 GGTTGTTTAACAGCTGATACAGG + Intergenic
911253460 1:95606955-95606977 GATATTTTAAAAGCTGAAACTGG + Intergenic
915297389 1:154930758-154930780 GATTCTTTCCCAAATGAAACTGG - Intronic
917813234 1:178680861-178680883 CATTGTTTCACAGCTGATACAGG + Intergenic
919475879 1:198033466-198033488 GCTAATTTTACAGCAGAAACAGG - Intergenic
921655577 1:217732190-217732212 AATTCTTTTACAGCTGATCTTGG - Intronic
921777795 1:219123030-219123052 GATTCGTTCCCAGCTCAAACTGG + Intergenic
922303192 1:224321414-224321436 GAATGTTTAAAAGCTGAAACAGG + Intronic
923674387 1:236066924-236066946 GATCCTGTAGCAGCTGAAACAGG - Intergenic
1063311162 10:4953632-4953654 TATTTTTTTACAGCAGAAATAGG - Intronic
1063997976 10:11639179-11639201 GATTTTTTTAAAGCTCATACAGG + Intergenic
1068778708 10:60896401-60896423 GATTCTTTTACAGCTGAAACAGG - Intronic
1069325391 10:67225877-67225899 AATTCTTTTTCAGGTAAAACAGG - Intronic
1070845646 10:79520987-79521009 GACACTTTAACATCTGAAACGGG + Intergenic
1072870085 10:99109493-99109515 GATTATTTCGCAGCTGAAACTGG + Intronic
1075333323 10:121591067-121591089 GAGTTTTTAACAGCTGAAAATGG - Intronic
1075612788 10:123866734-123866756 GATTCTTTTGCAGCAGACATTGG - Intronic
1076648131 10:131968618-131968640 GACTGTGTTACAGCTGAAACAGG + Intronic
1081149785 11:39613542-39613564 TATTGTTTAACAGCTGATACAGG - Intergenic
1082047983 11:47746228-47746250 GTTTCTTTTACTTCTGAAACTGG + Exonic
1084955554 11:72689436-72689458 GATTCACTTACAACCGAAACTGG + Intronic
1086557214 11:88125273-88125295 GAATCTAGTACAGATGAAACAGG - Intronic
1088239633 11:107759696-107759718 GATTCTTTTTCAGATAAATCAGG - Intergenic
1089826183 11:121280413-121280435 GATTCTTTTTCAGGTAAATCAGG + Intergenic
1090559424 11:127914823-127914845 AATTCTTTTTCAGCTAAATCAGG + Intergenic
1090884370 11:130862702-130862724 GATTCTTATGTAGCTGACACCGG - Intergenic
1091266358 11:134274723-134274745 GAATGTTTTCCAGCTGACACTGG + Intronic
1093023041 12:14220589-14220611 GATTTATTAACAGCTGAAAGAGG + Intergenic
1093525347 12:20098771-20098793 GATTCTCCTACAGTTGAAGCAGG - Intergenic
1093677332 12:21958768-21958790 GACTATTTTACACCTCAAACTGG + Intergenic
1098223185 12:68291954-68291976 GGTACTTTTACATCTGAAAGTGG - Intronic
1104511151 12:129379551-129379573 GAGTCTTTAACATCTGAACCTGG + Intronic
1106068692 13:26385198-26385220 TATTATTTTACAGCTGACATGGG + Exonic
1107215912 13:37918526-37918548 TATTCTTTGACAGCAGTAACTGG + Intergenic
1107253939 13:38400247-38400269 GATACTATTACAGCTCAAAATGG - Intergenic
1107666124 13:42693148-42693170 AATTCTTTTTCAGCTCAATCAGG + Intergenic
1108212401 13:48151567-48151589 TTTTTTTTTACAGCAGAAACAGG + Intergenic
1108604579 13:52024651-52024673 GATTCTTTTCCGGCCTAAACTGG - Exonic
1108866419 13:54928842-54928864 GATTCTTTAATAGCTTAAAAGGG + Intergenic
1111258608 13:85705554-85705576 GATGCTTTAACTGGTGAAACAGG + Intergenic
1112416203 13:99205425-99205447 GATTTTTTTGCAGCTGGGACAGG - Intronic
1114596416 14:23916062-23916084 GATTCTTGGACTGCAGAAACTGG - Intergenic
1116215396 14:42010701-42010723 AAATTTTTTACAACTGAAACAGG - Intergenic
1120810565 14:88799079-88799101 GATTTTTTTACAGCTAACTCAGG - Intergenic
1124458265 15:29864582-29864604 GATCCTTTTGCAGTTGAACCCGG - Intronic
1127008096 15:54593815-54593837 AATTCTTTTTCAGGTGAATCAGG + Intronic
1127337478 15:58003435-58003457 TATTCTTTAACAGGTTAAACTGG + Intronic
1128134184 15:65250501-65250523 GTTTATTTTACAGAAGAAACAGG - Intronic
1129072608 15:72963622-72963644 GTTTCTCCTACAGCTGAACCTGG + Intergenic
1129178180 15:73855042-73855064 CCTTCTTTTCCTGCTGAAACTGG - Intergenic
1131800808 15:96067722-96067744 GCTTCTTGTACAGCTGAAAAAGG + Intergenic
1138824213 16:60299097-60299119 GTATGTTTTACAGATGAAACTGG + Intergenic
1146095679 17:29928811-29928833 GATTTTTTTACAGTGGAAAGTGG + Intronic
1148947129 17:51273217-51273239 GCTTTTTTTAAAGCTGCAACTGG - Intronic
1150586111 17:66519565-66519587 GATTCTTTTACAAGTTATACTGG + Intronic
1150927763 17:69551825-69551847 GAGTCATTTAAAGCTGAAAGAGG + Intergenic
1153965822 18:10181431-10181453 AATTCTTTTTCAGGTGAATCAGG + Intergenic
1155232568 18:23787829-23787851 GATGTTCTTAAAGCTGAAACAGG + Intronic
1159127571 18:64242296-64242318 CATTCTTTTACAACTGAATGTGG - Intergenic
1159813601 18:73046142-73046164 CATTCTTTAACACCAGAAACTGG + Intergenic
1160052285 18:75445458-75445480 TATTCTTTTAAAGCAGAAAGAGG - Intergenic
925343431 2:3152168-3152190 AATTCTTTTTCAGGTGAATCAGG - Intergenic
931611274 2:64103659-64103681 GATTCTTTCACAAATCAAACTGG + Intronic
933934600 2:87192015-87192037 ATTTCTTTCACAGCTGAATCAGG - Intergenic
934819267 2:97357824-97357846 GATTTTTTTACAGCAGCTACAGG + Intergenic
935071927 2:99702156-99702178 GTTCCTTTTATAGCTGAAAATGG - Intronic
935628149 2:105188307-105188329 GATTCTTCTACACCTGGAGCTGG - Intergenic
936164560 2:110108189-110108211 AATTCTTTTTCAGGTGAATCAGG - Intronic
936358543 2:111773881-111773903 ATTTCTTTCACAGCTGAATCAGG + Intronic
936406477 2:112209239-112209261 GGTGCTTTTTCTGCTGAAACAGG + Intergenic
937171292 2:119872430-119872452 GAATATTTTACAGATGAAATAGG + Intronic
939260926 2:139807666-139807688 GTTTATTTTATAGCTGAAATGGG - Intergenic
939285347 2:140121963-140121985 CAGTCTTTTGCACCTGAAACTGG - Intergenic
940348756 2:152657196-152657218 TTTTTTTTTAGAGCTGAAACAGG - Intronic
941160343 2:162028031-162028053 GATTCTTTGACATCTCAGACTGG - Intronic
941474326 2:165930676-165930698 GACTGTTTTACAGATTAAACAGG + Intronic
941702222 2:168615371-168615393 GATTCTTTTTCAGGTCAATCAGG - Intronic
945339117 2:208630716-208630738 AATTCTTCTTCAGATGAAACTGG - Intronic
945757149 2:213861005-213861027 GAATTTATTACAGCTCAAACCGG - Intronic
945864646 2:215162363-215162385 GATTCTTTTTCAGGTAAATCAGG - Intergenic
946668062 2:222072138-222072160 GCTTTTTTTACAGAGGAAACAGG - Intergenic
1170046660 20:12092596-12092618 GTATCTTTTAAAGCTGAAAAAGG - Intergenic
1170428057 20:16255351-16255373 GATACTTTTATAGCTTAGACTGG + Intergenic
1170519633 20:17170675-17170697 GAATGTTTTACATCTTAAACTGG - Intergenic
1174470757 20:50759013-50759035 TATTATTTTACAGCACAAACTGG + Intergenic
1174989074 20:55489196-55489218 GCTTCAGTTACAGCTGGAACAGG - Intergenic
1177447403 21:21215969-21215991 TATTCTTTTATAACTGAAATAGG + Intronic
1179084089 21:38202466-38202488 GATTCTTTTTCAGGTAAATCAGG + Intronic
1182379263 22:29873004-29873026 GATTTTTTTCCAGCTGAAGTGGG + Intergenic
1185061531 22:48609591-48609613 GGTTCTTTTGCAGGAGAAACGGG - Intronic
949337852 3:2995695-2995717 GATTTTTTTACATATGAGACTGG + Intronic
949660535 3:6273055-6273077 TATTGTTTAACAGCTGATACAGG + Intergenic
949706492 3:6823959-6823981 TATTATTTTACATCTGAAAATGG + Intronic
950371886 3:12537751-12537773 GCTTCTTTTATAGATGAAAAGGG - Intronic
950640365 3:14344623-14344645 GAGTTTTTTCCAGCTGAGACAGG - Intergenic
951114356 3:18842710-18842732 AACTCTTTTTCAGCTGAAGCAGG - Intergenic
952039592 3:29246297-29246319 GATTTTTTTAAAGCTGTAAAAGG + Intergenic
952186126 3:30970921-30970943 GATGCTTTTAAAAATGAAACTGG - Intergenic
954621948 3:52001526-52001548 GAGTCATTTCCAGCAGAAACTGG + Intergenic
955203993 3:56878585-56878607 GTTTCTCTTACAGAGGAAACTGG - Intronic
955616121 3:60808627-60808649 GTTTCCTTTACAGCTGGAAAAGG + Intronic
955981202 3:64529476-64529498 GATTATTTGAGAGCTGAAACAGG + Intronic
957257298 3:77854775-77854797 GTTTCTTTCACAGCTGGAGCAGG + Intergenic
958067494 3:88562868-88562890 GTTTCTTTTCCAGCTAAAGCAGG + Intergenic
960635404 3:119780250-119780272 GAATTATTTACAGCAGAAACAGG - Intergenic
962381038 3:134898284-134898306 GATTTTTTTTCATCTGAAAATGG - Intronic
963336111 3:143974207-143974229 GTTTCTTTTAAAGCTAAAATGGG - Intronic
964926798 3:161968889-161968911 GATTGTTTTAAAGATGAGACAGG - Intergenic
965483158 3:169245048-169245070 GATTCTTTTATTGTTAAAACAGG - Intronic
965501350 3:169459754-169459776 GACCCTTATACACCTGAAACAGG - Intronic
967084037 3:186078105-186078127 GCTTATTTCACAGCTGAGACTGG + Intronic
967479215 3:189955075-189955097 GTTGCTTTTACAGCTGAAGGAGG - Intergenic
967999548 3:195195494-195195516 TATTTTTTTAAAGCTGAAAGAGG - Intronic
973741622 4:53924553-53924575 GATTCTTTTCCACTTGAAAGGGG + Intronic
975465595 4:74705506-74705528 GCTTCTTTGCCATCTGAAACTGG - Intergenic
976913427 4:90338443-90338465 CATTCTTTTGCAGCTTACACAGG + Intronic
977227697 4:94412897-94412919 CATTCTTTTACAGTGTAAACAGG - Intergenic
977690575 4:99904195-99904217 TATTGTTTAACAGCTGACACGGG + Intronic
978371573 4:108034514-108034536 GAATCTATTACTGCTGTAACTGG - Exonic
978446778 4:108787743-108787765 ACTTCTTTTACAGCTAAAATAGG + Intergenic
978922962 4:114207971-114207993 GTTGCTTTAACAGCTGATACAGG - Intergenic
979497397 4:121398604-121398626 CATTCATTCACAGCTCAAACTGG - Intergenic
981909326 4:149959882-149959904 GTTTCTTTTACAGTTAAAAATGG - Intergenic
987950317 5:24666115-24666137 GATTCTTTTGCAGCTGATGAAGG + Intergenic
988596692 5:32599966-32599988 CATACTTTTACATCTTAAACTGG + Intronic
989117299 5:37967598-37967620 GCTTAGCTTACAGCTGAAACAGG - Intergenic
989406171 5:41063709-41063731 GATGTTTTTAGAGTTGAAACTGG + Intronic
990525321 5:56620120-56620142 GAAACTTTTACAGGTGAACCAGG - Intergenic
992702448 5:79354299-79354321 GATTTTTTAAAAACTGAAACAGG - Intergenic
993009314 5:82461723-82461745 GATTCTTGCACAGCATAAACAGG + Intergenic
995004199 5:107171233-107171255 AATTCTTATACAGTTGAATCTGG - Intergenic
995292750 5:110477087-110477109 AGTTCTTTAACATCTGAAACAGG - Intronic
996119802 5:119658342-119658364 GATTCCTTTCCAGCTCAAGCTGG + Intergenic
999677202 5:154015776-154015798 AATTCTTTTTCAGTTGAATCAGG - Intronic
1001290809 5:170457849-170457871 AATTCTTTTTCAGGTGAAACAGG - Intronic
1001706352 5:173743866-173743888 TAATCTTTTACAGCAGTAACAGG + Intergenic
1007025713 6:38571124-38571146 GTTTCTTTTACATCTGAATAAGG + Intronic
1007244999 6:40454978-40455000 GTTTCTCTTAGAGCTGTAACTGG + Intronic
1008055516 6:46941707-46941729 GGTTCTGATACAGCTGACACAGG - Intronic
1008627195 6:53328365-53328387 GATTCTTTGATACCTGAATCAGG - Intronic
1008973476 6:57397652-57397674 AATTCTTTTTCAGGTGAATCAGG + Intronic
1009162381 6:60299196-60299218 AATTCTTTTTCAGGTGAATCAGG + Intergenic
1010045402 6:71437028-71437050 AATTCTTTTACAGGTAAATCAGG - Intergenic
1010164991 6:72905361-72905383 AATTCTTTTACAGGTAAATCAGG + Intronic
1010977415 6:82331575-82331597 GATTCTTTTCCTGCTGACAACGG + Intergenic
1011951139 6:92966127-92966149 GTTTATTTTAGAGCTGAAAAGGG - Intergenic
1012790112 6:103682442-103682464 GCTTCTTTAACTACTGAAACAGG - Intergenic
1020805685 7:12787585-12787607 GTTTCTTTTAAAGCTGAAAGTGG + Intergenic
1022780788 7:33580671-33580693 AAATTTTTTACAGATGAAACTGG + Intronic
1025772896 7:64529316-64529338 AATTCTTTTTCAGGTAAAACAGG - Intronic
1027711497 7:81607747-81607769 GATACGTTTCAAGCTGAAACTGG + Intergenic
1029854401 7:103500263-103500285 GATTCGTTGACTGCTGAAATGGG - Intronic
1030107227 7:105997320-105997342 CATTCTTTGACACCTGCAACTGG - Intronic
1030738247 7:113076719-113076741 GATTGTATTACTGCAGAAACAGG - Intergenic
1031498772 7:122485505-122485527 GATTCTATGACAGCTGAGAGAGG + Intronic
1032382526 7:131499734-131499756 GATCCTTTTATGGCAGAAACAGG + Intergenic
1032691438 7:134291167-134291189 TATTCTGTTACAGCTCAAAATGG - Exonic
1033135906 7:138783880-138783902 GATTCTTGGAAAGTTGAAACAGG + Intronic
1033936385 7:146590835-146590857 TGTTCTTTAACAGCTGATACAGG + Intronic
1033971955 7:147052449-147052471 GATTCTTTTATTGGTGGAACAGG + Intronic
1035685797 8:1522673-1522695 GCTTCTTTTTCAGCAGAAAGAGG + Intronic
1037430329 8:18806131-18806153 GATTTTTTTAAAGGTGAAACTGG + Intronic
1038959638 8:32505005-32505027 GAATATTTTACAGCTGAAGGAGG + Intronic
1039083181 8:33754657-33754679 GATTCTTTTTCAGGTAAACCAGG + Intergenic
1040017122 8:42708704-42708726 GATTCTTTTACAGCCACCACAGG + Exonic
1041055969 8:53986347-53986369 GTTTCTTTCACAGATTAAACTGG - Intronic
1041227880 8:55717857-55717879 GATTCTTTTTCAGGTAAATCAGG - Intronic
1041407339 8:57514476-57514498 TAATCTTTTACAGATAAAACAGG - Intergenic
1043270813 8:78330420-78330442 AATTCTTTTTCAGGTGAATCAGG - Intergenic
1043605214 8:81991326-81991348 GATTTCTCTACAGGTGAAACGGG + Intergenic
1045722666 8:105131908-105131930 GATTTATTTACAGTTGAAAGTGG - Intronic
1046064435 8:109180125-109180147 GATGCTTTTTTAGCTCAAACTGG - Intergenic
1047066239 8:121286822-121286844 GATTCTTTTGAAACTGTAACGGG + Intergenic
1048102095 8:131363872-131363894 TATTATTTTACAGCAGAAACTGG - Intergenic
1048328662 8:133457598-133457620 GAGGATTTTAAAGCTGAAACAGG + Exonic
1050907622 9:11025710-11025732 GCTACTTTTACAGCTCAAAATGG - Intergenic
1051160279 9:14199935-14199957 GAGTCTTTTACAGCTAAAATAGG + Intronic
1051225543 9:14895133-14895155 GACTTTTTTAAAGCTGAGACCGG - Intronic
1051520670 9:17983368-17983390 GATTCTTTAAAAGTTGAAAAGGG - Intergenic
1051553985 9:18362155-18362177 GATTCTCTCCCAGCTAAAACTGG + Intergenic
1052171908 9:25409847-25409869 GATTTTTTTACAGCAGCAATAGG - Intergenic
1053082880 9:35192204-35192226 CCTTCTTTTACAGCTTAAAATGG - Intronic
1053674833 9:40413302-40413324 GATTCTTATTCAGTTGAAATGGG - Intergenic
1053924625 9:43039663-43039685 GATTCTTATTCAGTTGAAATGGG - Intergenic
1054385937 9:64553369-64553391 GATTCTTATTCAGTTGAAATGGG - Intergenic
1054509787 9:65962991-65963013 GATTCTTATTCAGTTGAAATGGG + Intergenic
1058313871 9:103539832-103539854 GACTATTATACAGCTGAAAAAGG + Intergenic
1185703827 X:2251757-2251779 GTTTCTTTTCCAGCAGAAATCGG - Intronic
1186281709 X:7999953-7999975 GATGCTTTTACTGCTGATCCTGG + Intergenic
1188759475 X:34008916-34008938 GATTTTTTTAAATCTGCAACTGG - Intergenic
1192940193 X:75903821-75903843 AATACTTTAACAACTGAAACTGG - Intergenic
1194817143 X:98456759-98456781 GATTCTTTAACAGGAAAAACAGG - Intergenic
1195381764 X:104277903-104277925 GATACTTTTTAAGCTGAGACAGG - Intergenic
1196948165 X:120849575-120849597 AATTCTTTTTCAGGTGAATCAGG + Intergenic
1199782098 X:151070945-151070967 GGTTCTTTAACATCTGAAAATGG + Intergenic