ID: 1068778710

View in Genome Browser
Species Human (GRCh38)
Location 10:60896418-60896440
Sequence AGAATCAAATAGGATTTAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068778708_1068778710 -6 Left 1068778708 10:60896401-60896423 CCTGTTTCAGCTGTAAAAGAATC 0: 1
1: 0
2: 0
3: 10
4: 191
Right 1068778710 10:60896418-60896440 AGAATCAAATAGGATTTAAATGG No data
1068778707_1068778710 4 Left 1068778707 10:60896391-60896413 CCTCAGGGGTCCTGTTTCAGCTG 0: 1
1: 0
2: 3
3: 24
4: 242
Right 1068778710 10:60896418-60896440 AGAATCAAATAGGATTTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068778710 Original CRISPR AGAATCAAATAGGATTTAAA TGG Intronic
No off target data available for this crispr