ID: 1068783113

View in Genome Browser
Species Human (GRCh38)
Location 10:60943479-60943501
Sequence AGACACGGGGTTGCGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068783102_1068783113 13 Left 1068783102 10:60943443-60943465 CCTCCTGTTGTCACAGCAACTCA 0: 1
1: 0
2: 19
3: 504
4: 1675
Right 1068783113 10:60943479-60943501 AGACACGGGGTTGCGGGGGAGGG No data
1068783099_1068783113 28 Left 1068783099 10:60943428-60943450 CCCCTCATGGCAGCTCCTCCTGT 0: 1
1: 0
2: 2
3: 31
4: 282
Right 1068783113 10:60943479-60943501 AGACACGGGGTTGCGGGGGAGGG No data
1068783101_1068783113 26 Left 1068783101 10:60943430-60943452 CCTCATGGCAGCTCCTCCTGTTG No data
Right 1068783113 10:60943479-60943501 AGACACGGGGTTGCGGGGGAGGG No data
1068783103_1068783113 10 Left 1068783103 10:60943446-60943468 CCTGTTGTCACAGCAACTCACAA 0: 1
1: 0
2: 5
3: 216
4: 4840
Right 1068783113 10:60943479-60943501 AGACACGGGGTTGCGGGGGAGGG No data
1068783100_1068783113 27 Left 1068783100 10:60943429-60943451 CCCTCATGGCAGCTCCTCCTGTT 0: 1
1: 0
2: 7
3: 71
4: 569
Right 1068783113 10:60943479-60943501 AGACACGGGGTTGCGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068783113 Original CRISPR AGACACGGGGTTGCGGGGGA GGG Intronic
No off target data available for this crispr