ID: 1068783138

View in Genome Browser
Species Human (GRCh38)
Location 10:60943592-60943614
Sequence CAGTATGGGGAGGCCGGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 677
Summary {0: 1, 1: 1, 2: 2, 3: 59, 4: 614}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068783138_1068783148 -10 Left 1068783138 10:60943592-60943614 CCCCGCCCGGCCTCCCCATACTG 0: 1
1: 1
2: 2
3: 59
4: 614
Right 1068783148 10:60943605-60943627 CCCCATACTGGCCTTCGAAGGGG No data
1068783138_1068783153 12 Left 1068783138 10:60943592-60943614 CCCCGCCCGGCCTCCCCATACTG 0: 1
1: 1
2: 2
3: 59
4: 614
Right 1068783153 10:60943627-60943649 GAAGCGCCTTCTCGTCGGCGCGG No data
1068783138_1068783155 29 Left 1068783138 10:60943592-60943614 CCCCGCCCGGCCTCCCCATACTG 0: 1
1: 1
2: 2
3: 59
4: 614
Right 1068783155 10:60943644-60943666 GCGCGGCACCACCCCCTCCCTGG No data
1068783138_1068783152 7 Left 1068783138 10:60943592-60943614 CCCCGCCCGGCCTCCCCATACTG 0: 1
1: 1
2: 2
3: 59
4: 614
Right 1068783152 10:60943622-60943644 AAGGGGAAGCGCCTTCTCGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068783138 Original CRISPR CAGTATGGGGAGGCCGGGCG GGG (reversed) Intronic
900209959 1:1450542-1450564 GAGGATGGGGAGGCAGGGCTGGG + Exonic
900220014 1:1503446-1503468 GAGGATGGGGAGGCAGGGCTGGG + Intergenic
900222321 1:1515873-1515895 GAGGATGGGGAGGCAGGGCTGGG + Intronic
900476404 1:2878341-2878363 CAGAGTGGGGAGGCGGGGTGAGG + Intergenic
900480244 1:2894716-2894738 CAGGGTGGGGAGGCAGGGTGGGG - Intergenic
901081857 1:6588214-6588236 CAGGATGGGGAGGCGAGGGGAGG - Intronic
901209777 1:7518345-7518367 CAGGATGGAGAGGCCGGTGGAGG - Intronic
901344803 1:8530493-8530515 CAAAATGGGGAGGCGGGGCGGGG + Intronic
901437703 1:9258106-9258128 GAGTATGGGGAGGAGCGGCGCGG + Intronic
901539417 1:9905718-9905740 TAGGGTGGTGAGGCCGGGCGCGG - Intronic
901632258 1:10653642-10653664 CAGTATGGGGAAGTAGGGCGTGG + Exonic
901651973 1:10748188-10748210 CAGTAAGGACAGGCCGGGCCTGG - Intronic
901708513 1:11095421-11095443 GAGTAAGGGAAGGCCGGGTGTGG + Intronic
902077448 1:13799151-13799173 AAGAATTGTGAGGCCGGGCGCGG + Intronic
902181900 1:14695792-14695814 CAGGGTGGAGAGGCCGGGCACGG - Intronic
902271207 1:15306562-15306584 CAGCATGGGGACCCCGGGCCTGG - Intronic
902412101 1:16217651-16217673 CAGGCTGGGGAGGAGGGGCGCGG - Intergenic
902591719 1:17479836-17479858 CAGAACGGGGAGGCCAGGCGTGG + Intergenic
902808748 1:18876405-18876427 CAGGATGGTGAGGCTGGGTGAGG + Exonic
902941814 1:19805576-19805598 CAGTGAGGGGTGGCCGGGTGCGG - Intergenic
903117253 1:21188444-21188466 GAGTATGGGCAGGCCAGGCCAGG - Intergenic
903378915 1:22883664-22883686 CAGAGTGGGAAGGCCGGGCTGGG - Intronic
904285052 1:29448692-29448714 GAGAAGGGGGAGGCTGGGCGGGG - Intergenic
904397447 1:30231326-30231348 CAGTGTGGGAAGGCAGGGAGAGG - Intergenic
904565032 1:31423815-31423837 CATTATGCTGAGCCCGGGCGTGG + Exonic
904572076 1:31473646-31473668 CAGTATGGGGACCCTGGGCCTGG + Intergenic
904809698 1:33155359-33155381 GAGTCAGGGGAGGCCGGGCATGG - Intronic
905263846 1:36737938-36737960 GATTATGGGGAGGACGGGTGGGG - Intergenic
905639792 1:39581218-39581240 AAGGAGGCGGAGGCCGGGCGCGG + Intergenic
906573310 1:46863191-46863213 AAGCATGGTGAGGCCGGGCGTGG + Intergenic
907419574 1:54337783-54337805 AAGTTTGAGGAGGCCGGGCATGG - Intronic
908318839 1:62961628-62961650 CAGAATGGGGAGGAGGGGGGTGG - Intergenic
908347536 1:63250608-63250630 TATTATGGGCTGGCCGGGCGTGG - Intergenic
908474907 1:64477922-64477944 TAATCTGGGGGGGCCGGGCGCGG - Intronic
908926878 1:69266082-69266104 AAGTCAGGAGAGGCCGGGCGCGG - Intergenic
909014617 1:70369005-70369027 CAGTCTGGGGAGGAGGGGAGAGG - Intronic
909107805 1:71434799-71434821 AACAAGGGGGAGGCCGGGCGCGG + Intronic
909257051 1:73437672-73437694 AAGTATGTGGCGGCCAGGCGCGG - Intergenic
910013967 1:82497921-82497943 AAGTATGCAGCGGCCGGGCGCGG - Intergenic
911056652 1:93714269-93714291 AAGTATGATGGGGCCGGGCGCGG - Intronic
911457223 1:98140846-98140868 GAGTATGGGGAGGCAGGGAATGG - Intergenic
911510712 1:98805331-98805353 CAGTCTGGGGAGGAGGGGAGAGG + Intergenic
912004911 1:104886006-104886028 AAAAATGGGCAGGCCGGGCGCGG - Intergenic
913028686 1:114874020-114874042 CACTATGTGGAGGCTGGGTGTGG - Intronic
914391205 1:147224799-147224821 CAGTGTCAGGTGGCCGGGCGCGG - Intronic
914789909 1:150868609-150868631 CAGCCTGGGCAGGCCGGGCGCGG + Intronic
915035960 1:152925209-152925231 AAGTATATGTAGGCCGGGCGCGG - Intergenic
915453304 1:156021792-156021814 AAGTGCAGGGAGGCCGGGCGTGG - Intergenic
915485878 1:156220252-156220274 CAGCATGGGCAGGCCGGGCATGG - Intronic
915566251 1:156714776-156714798 AATTTGGGGGAGGCCGGGCGTGG - Intergenic
915910337 1:159910959-159910981 CAGCATGGGGAGGCCCAGCAGGG + Intergenic
918252260 1:182713472-182713494 CATTAAAGAGAGGCCGGGCGTGG - Intergenic
918604046 1:186400278-186400300 AAGAATGGGGAGGCCGGGCGCGG - Intronic
919091025 1:192979204-192979226 CAGTCTGGGGAGGAGGGGAGAGG + Intergenic
919601195 1:199624585-199624607 AGGTAAGGGGAGGCCAGGCGTGG - Intergenic
919840123 1:201602848-201602870 CAGGATGGGGAGGCTGGGTGAGG - Intergenic
920118218 1:203636325-203636347 CAGGATGGGGAGGCGGGGGTGGG - Intronic
920181336 1:204133819-204133841 GAGCACGGTGAGGCCGGGCGCGG - Intronic
920204274 1:204280522-204280544 CAGGATGGGGAAGCTGGGCCAGG - Intronic
920404102 1:205696311-205696333 CATTATGGGTAGACCGGGCGTGG - Intergenic
920666049 1:207963665-207963687 CAGGCTCGGGAAGCCGGGCGCGG + Intergenic
921015825 1:211189841-211189863 AAGTAAGAGTAGGCCGGGCGCGG - Intergenic
921204272 1:212834739-212834761 AAATGTGGAGAGGCCGGGCGCGG - Intronic
921509168 1:216009665-216009687 CAGTCTGGGGAGGAGGGGAGAGG - Intronic
921835264 1:219771973-219771995 GAGGATTGGGAGGCCGGGCGCGG - Intronic
922014693 1:221633464-221633486 AAGAATGGAAAGGCCGGGCGCGG - Intergenic
923623463 1:235595740-235595762 CAGTCTGGTGAGGCCCGGGGTGG - Intronic
923809154 1:237293495-237293517 AAGTAGGGGCAGGCCGGGTGCGG - Intronic
924151545 1:241135134-241135156 CAGCATGTTGCGGCCGGGCGCGG + Intronic
924466225 1:244301457-244301479 AAGTCTAGGGAGGCCAGGCGCGG + Intergenic
1062841964 10:679235-679257 GGGTGTGGGGAGGACGGGCGCGG - Intronic
1062849092 10:729209-729231 CAGCATGGGGAGGGCTGGGGCGG - Intergenic
1063151462 10:3340313-3340335 CGGTGTGGGGAGGCGGGGAGGGG + Intergenic
1064359472 10:14650574-14650596 AAGTATCGAGAGGCCGGGCGCGG - Intronic
1066062524 10:31736663-31736685 CAGTATGGGGACCCTGGGCCTGG + Intergenic
1066076902 10:31887945-31887967 TAGGAAGGGCAGGCCGGGCGCGG - Intronic
1067701509 10:48576315-48576337 GAGAATGGGGAGGCCAGGCCAGG - Intronic
1067710555 10:48648268-48648290 GAGTATGGGAAGGCAGGGCAGGG + Intronic
1067848597 10:49741030-49741052 CAGGCTGGGGAGGCCTGGTGGGG - Intronic
1068342926 10:55732642-55732664 AAGTAAGAGGAGGCCAGGCGCGG + Intergenic
1068360685 10:55972836-55972858 CAGTCTGGGGAGGAGGGGAGAGG - Intergenic
1068783138 10:60943592-60943614 CAGTATGGGGAGGCCGGGCGGGG - Intronic
1068895124 10:62190502-62190524 CAGTAGGGTGATGCCAGGCGAGG - Intronic
1069338273 10:67379729-67379751 TAGTCTGGAGAGGCCGGGCGCGG + Intronic
1069606086 10:69739668-69739690 CAGCATGGGCAGGCGGGGTGTGG + Intergenic
1069894071 10:71669736-71669758 CAGAATGGGGAGGCCAGGCACGG - Intronic
1069959367 10:72070557-72070579 CAGTGTGGGGAGGGTGGGCAGGG - Intronic
1069989281 10:72304630-72304652 CAATGTTAGGAGGCCGGGCGCGG + Intergenic
1072673684 10:97450159-97450181 AATTAAGGGGAGGCCGGGCACGG - Intronic
1073181687 10:101587496-101587518 CAGTTTGGGGAAGCGGGTCGGGG + Intronic
1073387010 10:103134301-103134323 CAGCATGGGGAGCCTGGGCCTGG - Intronic
1073394485 10:103206834-103206856 CAGTCTGGGGAGGAGGGGAGAGG - Intergenic
1074840286 10:117344675-117344697 TAGCATGGAGTGGCCGGGCGTGG - Intronic
1075128373 10:119719344-119719366 AAAAATGGGGTGGCCGGGCGTGG - Intergenic
1075720978 10:124587323-124587345 CAGAAAGTGGAGGCCGGGCGCGG - Intronic
1075992555 10:126850131-126850153 CAGAATGTGATGGCCGGGCGCGG + Intergenic
1076155112 10:128198371-128198393 GAGTCTGGGGAGTCCAGGCGTGG - Intergenic
1076184536 10:128435962-128435984 CAGTGTGGGGAGCCTGGGCTCGG + Intergenic
1076552512 10:131291714-131291736 CTGTTTATGGAGGCCGGGCGCGG - Intronic
1076750778 10:132541790-132541812 CAGTATGGGGAGGGAGGACTGGG - Intronic
1077229018 11:1450454-1450476 CAGTGGCGGGAGGCCGGGCTGGG - Intronic
1077314682 11:1913434-1913456 CAGAAAGCGGGGGCCGGGCGCGG - Intergenic
1077339076 11:2018030-2018052 CATTCTGGGGAGCCTGGGCGGGG + Intergenic
1078284674 11:9940111-9940133 CACTATGCTAAGGCCGGGCGCGG + Intronic
1078692691 11:13597788-13597810 GAGAAGGGAGAGGCCGGGCGTGG + Intergenic
1079330462 11:19528639-19528661 AAGAATGGGAAGGCCGGGCACGG + Intronic
1080579984 11:33634331-33634353 CAGTAAGCGCAGGCCGGGCGTGG - Intronic
1081316092 11:41632286-41632308 TACTATGGTGAGGCCGGGCACGG + Intergenic
1081644926 11:44783685-44783707 TAGTCTTGGGAGGCCGGGCGCGG - Intronic
1082002338 11:47400147-47400169 CGCTCTGGGGAGGCCGGGGGCGG + Intergenic
1082816068 11:57510164-57510186 AAAGATGGGCAGGCCGGGCGCGG + Intronic
1083210920 11:61185459-61185481 GTGTATGGCCAGGCCGGGCGCGG + Intergenic
1083400898 11:62422862-62422884 TAGTAAGGGGAGGCTGGGCGTGG - Intronic
1083436183 11:62645244-62645266 CAGTGAGTTGAGGCCGGGCGCGG + Intronic
1084149344 11:67280935-67280957 CAGCATGGGGAGGCCGGAGCAGG + Intronic
1084192164 11:67504247-67504269 CAGTGCGGGGAGGCTGCGCGCGG + Intronic
1084277825 11:68064158-68064180 CAGCATGGGAAGGCCGAGCTGGG + Intronic
1084393667 11:68894972-68894994 AAGAGTGGGCAGGCCGGGCGTGG + Intronic
1084491298 11:69480053-69480075 CAGTGGGGCGAGGCCTGGCGTGG + Intergenic
1084861700 11:72023027-72023049 CAGACTGGGGAGGCAGGGCAGGG - Intronic
1085477496 11:76797366-76797388 CAGCAAGGGGAGCCCAGGCGGGG - Exonic
1085567064 11:77523706-77523728 AAGTATGAAGAGGCCGGGTGTGG - Intronic
1086336097 11:85802102-85802124 GAGAATGGGGAGGCCAGGCACGG - Intronic
1086666722 11:89491975-89491997 CAGTATGGGATGGGCGGGCAAGG - Intronic
1087290267 11:96313513-96313535 AATTTTGGGGAGGCTGGGCGAGG - Intronic
1088654531 11:111986652-111986674 AAGTATGGGTGGGCCAGGCGTGG - Intronic
1090804868 11:130196553-130196575 CAGTATCTGGAGGGGGGGCGGGG - Exonic
1091240734 11:134050604-134050626 CGGTTTGGGGAGGGCGGGGGAGG + Intergenic
1091282568 11:134390356-134390378 AAGGATGGGGAGGCTGGGCCTGG + Exonic
1202822060 11_KI270721v1_random:73212-73234 CATTCTGGGGAGCCTGGGCGGGG + Intergenic
1091530781 12:1353318-1353340 CATTATTTGTAGGCCGGGCGCGG - Intronic
1091717722 12:2791646-2791668 AAGTATGTAGAGGCCGGGCACGG + Intergenic
1092182800 12:6457646-6457668 CTGTATAGTGAGGCCGGGCAGGG - Exonic
1092242803 12:6845849-6845871 CAGAATGGGGAGGGAGGGCTGGG - Intronic
1092460645 12:8682924-8682946 CAGTAGTTGCAGGCCGGGCGCGG - Intronic
1092795938 12:12110377-12110399 AACAATGTGGAGGCCGGGCGCGG - Intronic
1093338397 12:17938431-17938453 CAGTATGAGATGGCCGGGCGCGG - Intergenic
1093802538 12:23390804-23390826 AAGAATGTTGAGGCCGGGCGCGG - Intergenic
1094015356 12:25857037-25857059 AAGAATTGGGAAGCCGGGCGCGG + Intergenic
1094046666 12:26174809-26174831 TGGTAGGGGGAGGCCGGGCACGG - Intronic
1094474154 12:30828368-30828390 CAATATGGGGGGGCAGGGGGAGG - Intergenic
1095472154 12:42548828-42548850 AAGAAGGGTGAGGCCGGGCGCGG + Intronic
1095766769 12:45904400-45904422 TACTATGGAGAGGCTGGGCGCGG + Intronic
1096446750 12:51699874-51699896 AAGTAGTTGGAGGCCGGGCGCGG + Intronic
1096674648 12:53220036-53220058 CTGTACGGGGCGGCCGGGCCCGG - Intronic
1097126838 12:56783242-56783264 CCGGACGGGGTGGCCGGGCGGGG + Intronic
1097127793 12:56789057-56789079 CCGGACGGGGCGGCCGGGCGGGG + Intergenic
1097212229 12:57380937-57380959 AAGAATGGGCAGGCCGGGCACGG + Intronic
1098342768 12:69469476-69469498 GAGTAGGGGTTGGCCGGGCGCGG - Intergenic
1098358983 12:69636848-69636870 AAGTCTGAGGGGGCCGGGCGCGG - Intergenic
1098583650 12:72131360-72131382 CATTAAGTAGAGGCCGGGCGCGG - Intronic
1099153579 12:79146045-79146067 CACTATGTTTAGGCCGGGCGCGG - Intronic
1099321578 12:81157516-81157538 AAGTATAGGGAAGCTGGGCGCGG + Intronic
1099350479 12:81562555-81562577 GAGTATGTTGAGGCCGGGCGCGG + Intronic
1099808979 12:87556650-87556672 CAGTATGGGGAAGGTGGGAGGGG + Intergenic
1099973177 12:89521391-89521413 AAGTGAGGGGAGGCCGGGTGCGG - Exonic
1099990995 12:89720495-89720517 AAGTATTGACAGGCCGGGCGCGG + Intergenic
1100297823 12:93278970-93278992 CAGTAAGGGGAGGTGGGGCCAGG + Intergenic
1100589480 12:96012419-96012441 CAGTATATTGAGGCCGGGCACGG + Intronic
1101412836 12:104483494-104483516 GTGCATGGGGAGGCCGGGCACGG - Intronic
1101594957 12:106155940-106155962 TAGGATTGAGAGGCCGGGCGCGG - Intergenic
1101603224 12:106228315-106228337 GAATATGGGGAGGCCAGGCATGG + Intergenic
1101793187 12:107949425-107949447 AAGTCATGGGAGGCCGGGCGCGG + Intergenic
1101900079 12:108785410-108785432 CTGTATGATGGGGCCGGGCGCGG - Exonic
1101978465 12:109383830-109383852 CAGTATGTGGAGTCGGGGTGGGG - Intronic
1102084377 12:110124247-110124269 CAGGGCGGGGAGGACGGGCGCGG - Intergenic
1103621654 12:122190570-122190592 TGATAGGGGGAGGCCGGGCGCGG + Intronic
1103907718 12:124335911-124335933 CAGGTGGTGGAGGCCGGGCGAGG + Intronic
1104120585 12:125795460-125795482 CAGAAGGAGGGGGCCGGGCGCGG - Intergenic
1104837331 12:131800051-131800073 CAGCATGGTGAGGCGGGGCTGGG - Intergenic
1105049567 12:133036829-133036851 GAGTATTGGTGGGCCGGGCGCGG + Intergenic
1105561977 13:21500707-21500729 CAGTAGGGATTGGCCGGGCGTGG - Intronic
1106115957 13:26817907-26817929 CAGATTGGGGAGGCAGGGCTGGG + Intergenic
1106143444 13:27030969-27030991 ATGGGTGGGGAGGCCGGGCGTGG + Intergenic
1107157219 13:37182921-37182943 CAGTATGGGAAGGTCTGGCCAGG + Intergenic
1107340527 13:39400491-39400513 AAGAATGGCAAGGCCGGGCGCGG + Intronic
1107483356 13:40803477-40803499 GAATATGGGGAGGCCAGGCGTGG - Intronic
1107788633 13:43978619-43978641 CAGGAAGGGGAGGCTGGGCATGG + Intergenic
1107991290 13:45820918-45820940 CAGTCTGGGGAGGACGGAGGTGG - Intronic
1107999835 13:45895926-45895948 CAGTGGAGGGAGGCCAGGCGGGG - Intergenic
1108273717 13:48787578-48787600 GAGCAAGAGGAGGCCGGGCGCGG + Intergenic
1108299982 13:49064050-49064072 TAGTCTGTGGAGGCCAGGCGTGG + Intronic
1108421490 13:50254555-50254577 TAGTGTTTGGAGGCCGGGCGCGG + Intronic
1108662796 13:52601470-52601492 TACTCTGGGCAGGCCGGGCGCGG - Intergenic
1108829501 13:54459859-54459881 ACCTATGAGGAGGCCGGGCGCGG - Intergenic
1109980844 13:69903928-69903950 AAGTATGTGAGGGCCGGGCGCGG - Intronic
1110412269 13:75217503-75217525 CAGTATGGGGGGGGCGTGTGAGG + Intergenic
1110464604 13:75786673-75786695 AAGTAGAGAGAGGCCGGGCGCGG - Intronic
1110490216 13:76095184-76095206 TAATAGGGTGAGGCCGGGCGCGG + Intergenic
1113067250 13:106384852-106384874 CAGTATGGGGAGGCCGTATGTGG + Intergenic
1113141465 13:107156392-107156414 TAGTAAGGAGAGGCCGGGCATGG - Intergenic
1113480059 13:110614198-110614220 TATTATGAAGAGGCCGGGCGTGG - Intergenic
1113785911 13:113002036-113002058 CAGTGCGGGGACGCCGGGCGGGG + Intronic
1115399428 14:32939839-32939861 CAGGAGGAGGAGGCCGGGGGCGG + Intronic
1115695865 14:35898084-35898106 CAGTATGTGGAGGTAGGGAGGGG + Intronic
1115826665 14:37285880-37285902 AAGACTGGAGAGGCCGGGCGCGG - Intronic
1115954852 14:38766168-38766190 AAGAATGTTGAGGCCGGGCGTGG - Intergenic
1116367227 14:44082611-44082633 AAGTCTTGGGAGGCCGGGCATGG - Intergenic
1116665045 14:47764159-47764181 AAGGATGAGGAGGCCGGGCGCGG + Intergenic
1116816083 14:49585077-49585099 CATTTTGGGTTGGCCGGGCGCGG + Intronic
1116841631 14:49824252-49824274 AAGTCTGAGGAGGCGGGGCGTGG + Intronic
1116891248 14:50270794-50270816 CAGTAAGGCCTGGCCGGGCGCGG - Intronic
1117255202 14:53970256-53970278 GAGGATGGGTCGGCCGGGCGCGG - Intergenic
1117363099 14:54997620-54997642 AAAAATGGGGAGGCCGGGCATGG + Intronic
1118943413 14:70359979-70360001 AAGTATTTTGAGGCCGGGCGCGG + Intronic
1119894353 14:78207152-78207174 CAATGTGGGGAGGCCGGGCGCGG - Intergenic
1120306811 14:82781133-82781155 AAGGAAGGAGAGGCCGGGCGTGG - Intergenic
1121010163 14:90515364-90515386 TAGTAAGGGGTGGCTGGGCGTGG - Intergenic
1121052610 14:90829326-90829348 GAGTGCGGGCAGGCCGGGCGCGG + Intergenic
1122089952 14:99331363-99331385 CAGGAGGGGGAGGCCAGGTGAGG - Intergenic
1123668681 15:22630569-22630591 AAGCAGGGGGAGGCCAGGCGCGG - Intergenic
1124461592 15:29897168-29897190 CAGTATGGGGACCCTGGGCCTGG - Intronic
1124524658 15:30437046-30437068 AAGCAGGGGGAGGCCAGGCGTGG - Intergenic
1124530964 15:30505862-30505884 ATGTATAGGGCGGCCGGGCGCGG - Intergenic
1124767691 15:32501833-32501855 ATGTATAGGGCGGCCGGGCGCGG + Intergenic
1124773995 15:32570666-32570688 AAGCAGGGGGAGGCCAGGCGTGG + Intergenic
1124781590 15:32641616-32641638 CAGTCTGGGGAGTCCTGGCGAGG + Intergenic
1125682861 15:41543772-41543794 AAGAATGGGTTGGCCGGGCGCGG + Intronic
1125957885 15:43803140-43803162 CACTTTGGGGAGGCTGGGCTGGG + Intergenic
1126066240 15:44828252-44828274 AAGAATGGGAAGGCCGGGCGTGG - Intergenic
1126444516 15:48727329-48727351 AAGTATGTGAAGGCCGGGCGCGG - Intronic
1127104743 15:55600991-55601013 TAGAACGTGGAGGCCGGGCGCGG - Intergenic
1127186114 15:56482467-56482489 AAGTCCAGGGAGGCCGGGCGCGG - Intergenic
1127199274 15:56625843-56625865 AAGGAAGTGGAGGCCGGGCGTGG + Intergenic
1127200178 15:56637469-56637491 CATTATGGAGAGGCCAGGTGTGG - Intronic
1127481699 15:59383787-59383809 CAGCCTGGAAAGGCCGGGCGCGG + Intronic
1127494168 15:59493876-59493898 AAGAAGGAGGAGGCCGGGCGCGG - Intronic
1128303660 15:66583413-66583435 GAGTAAGGGTGGGCCGGGCGCGG - Intronic
1128338413 15:66803147-66803169 CAGGATGGGGAGGCAGGGGGAGG - Intergenic
1129199883 15:73992354-73992376 CAGGAAGAGGAGGCCGGCCGGGG + Intronic
1129803869 15:78438271-78438293 AAGAAGGGGGAGGCCGGGCAGGG - Exonic
1131003054 15:88953850-88953872 CAATATGAGTAGGCCCGGCGTGG - Intergenic
1131164766 15:90134430-90134452 CAGTTTGGGGAGGAGGGGAGAGG - Intergenic
1131265395 15:90912430-90912452 CAGCATGGGGAAGCAGGGCACGG + Intronic
1131684086 15:94752399-94752421 CAGTCTGGGGAGGAGGGGAGAGG - Intergenic
1132040163 15:98518494-98518516 AAGAAATGGGAGGCCGGGCGCGG - Intergenic
1132839738 16:1973149-1973171 TAGGTAGGGGAGGCCGGGCGCGG + Intronic
1132860188 16:2066950-2066972 AAGTAGAGGCAGGCCGGGCGTGG - Intronic
1132900392 16:2251108-2251130 AAGTTGGCGGAGGCCGGGCGCGG - Intronic
1133627412 16:7584039-7584061 CATTATGGGGAGACAGGGCATGG + Intronic
1133788437 16:8990680-8990702 CAGCATTGGGAGGCCAGGGGAGG + Intergenic
1134117799 16:11562209-11562231 CAGTGTGGAGAGGCAGGGCACGG - Intronic
1134245709 16:12538378-12538400 GTGCAAGGGGAGGCCGGGCGCGG - Intronic
1134423764 16:14118507-14118529 AAAGATGGGGAGGCCTGGCGTGG + Intronic
1135009273 16:18859926-18859948 CAGTAAGTCGAGGCCAGGCGTGG + Intronic
1135616739 16:23917365-23917387 CAGAATGAGGTGGCCGGGCGTGG - Intronic
1136023909 16:27457670-27457692 ACGTTTGTGGAGGCCGGGCGCGG + Intergenic
1136312984 16:29427553-29427575 CAGTAAGTCGAGGCCAGGCGTGG + Intergenic
1136403649 16:30031178-30031200 CAGCTTGGGGAGGACGGGGGAGG + Exonic
1136652305 16:31683275-31683297 GAGTAAGGACAGGCCGGGCGCGG + Intergenic
1136774001 16:32861492-32861514 AAGCATGTGGAGGCTGGGCGTGG - Intergenic
1136896608 16:34000027-34000049 AAGCATGTGGAGGCTGGGCGTGG + Intergenic
1137055479 16:35744369-35744391 CAGTCTGGGGAGGAGGGGAGAGG + Intergenic
1139098500 16:63735047-63735069 AAGAATGTGGAGGCTGGGCGCGG - Intergenic
1139887620 16:70221624-70221646 CAGTAAGTCGAGGCCAGGCGTGG + Intergenic
1139906993 16:70372940-70372962 AAGGATGGATAGGCCGGGCGTGG + Exonic
1140080919 16:71746298-71746320 AAGAAGTGGGAGGCCGGGCGTGG - Intronic
1140233798 16:73140563-73140585 ACAAATGGGGAGGCCGGGCGTGG + Intronic
1140309555 16:73835759-73835781 AAGAAAGTGGAGGCCGGGCGTGG - Intergenic
1140461142 16:75140667-75140689 CACTTGGGGGAGGCCGGGCACGG + Intergenic
1140737170 16:77908623-77908645 CAGGAAAAGGAGGCCGGGCGCGG + Intronic
1141056010 16:80815086-80815108 CTGTTGGGGGAGGCCGGGGGTGG - Intergenic
1141769206 16:86078858-86078880 CAGTAAGGGCAGGCCGGGCACGG + Intergenic
1141832985 16:86520015-86520037 CAGCCAGGGGAGGCTGGGCGAGG + Intergenic
1142364531 16:89643110-89643132 CAGGATCTGGAGGCTGGGCGTGG - Intergenic
1203076423 16_KI270728v1_random:1123603-1123625 AAGCATGTGGAGGCTGGGCGTGG - Intergenic
1142689087 17:1594113-1594135 CAGAAGCAGGAGGCCGGGCGCGG - Intronic
1142706722 17:1699883-1699905 AACTAAGGTGAGGCCGGGCGCGG - Intergenic
1143241321 17:5445367-5445389 AAGAGTGGTGAGGCCGGGCGCGG - Intronic
1143423477 17:6814546-6814568 CAGAAAGGGGAGGCCAGGGGCGG + Intronic
1144578371 17:16443918-16443940 CAGTGTGGTGAGGCGGGGCAGGG + Exonic
1144588035 17:16500500-16500522 AAGGAGGAGGAGGCCGGGCGTGG + Intergenic
1144638563 17:16925623-16925645 CAGCTAGGGGAGGCCGGGCAGGG + Intergenic
1144828815 17:18120862-18120884 CCGTAGGGCGAGGCCGGCCGGGG - Exonic
1144950902 17:18992878-18992900 CTGTGTGGGGAGGCAGGGAGAGG - Intronic
1145867667 17:28251195-28251217 AAGTACGTGGGGGCCGGGCGCGG - Intergenic
1146193089 17:30787702-30787724 AAGTATGGGGAGGAGGGGCCGGG + Intronic
1146246147 17:31284828-31284850 AACAATGTGGAGGCCGGGCGTGG + Intronic
1146943754 17:36860602-36860624 CAGTGAGGGGAGCCCGGGCAGGG + Intergenic
1147752695 17:42745933-42745955 AAGAAGAGGGAGGCCGGGCGTGG - Intergenic
1147847309 17:43413615-43413637 CAGAATGATGGGGCCGGGCGCGG + Intergenic
1147948612 17:44094345-44094367 AAAAAGGGGGAGGCCGGGCGCGG + Intronic
1147962226 17:44174811-44174833 TAGTATTTGGAAGCCGGGCGTGG + Intronic
1148044721 17:44736272-44736294 AAGTAAATGGAGGCCGGGCGTGG - Intronic
1148326247 17:46785065-46785087 CAAAAAGGGGAGGCCGGGCACGG - Intronic
1149390907 17:56189458-56189480 AAGTCAGGGCAGGCCGGGCGCGG - Intronic
1151303224 17:73244270-73244292 CAGTATTTTGGGGCCGGGCGCGG + Intronic
1151626417 17:75278689-75278711 CAGGAAGGTGAGGCCAGGCGCGG + Intronic
1152075727 17:78158583-78158605 GTGTAGGAGGAGGCCGGGCGCGG - Intronic
1152106801 17:78334951-78334973 CAGGATGGGGAGGGCGAGCTGGG - Intergenic
1152509592 17:80776946-80776968 GTGAAGGGGGAGGCCGGGCGTGG + Intronic
1152589435 17:81204137-81204159 CATTGTGGGGAGGGAGGGCGAGG + Intronic
1152969401 18:147342-147364 CAGTGCAGTGAGGCCGGGCGCGG + Intergenic
1153192710 18:2559982-2560004 CACTATGGGGAGGCCGAGGTGGG - Intronic
1153204519 18:2682610-2682632 AAGTATCAGGGGGCCGGGCGCGG - Intronic
1153231806 18:2944638-2944660 AGGTTTGTGGAGGCCGGGCGCGG - Intronic
1153268586 18:3296402-3296424 AAAGGTGGGGAGGCCGGGCGCGG - Intergenic
1154088260 18:11328712-11328734 CAGGATGAAGAGGCTGGGCGCGG - Intergenic
1154255670 18:12779015-12779037 CGGCGTGGGGAGGCCTGGCGTGG - Intergenic
1155008789 18:21754419-21754441 CAGTGTGGGGAGGCTGGACACGG - Intronic
1155123768 18:22849780-22849802 AAGAATGGGCCGGCCGGGCGCGG - Intronic
1155471068 18:26193563-26193585 TAGTAGGGGAAGGCCAGGCGTGG + Intergenic
1156365833 18:36426192-36426214 TAGTGTGTGAAGGCCGGGCGCGG - Intronic
1156474133 18:37394955-37394977 CAGTGAGTGGAGGCCGGGTGGGG - Intronic
1157223158 18:45841316-45841338 CAGTAGGGGCAGCCCGGGAGAGG + Intronic
1157252218 18:46104776-46104798 CAGTGTTGGGATGCAGGGCGCGG - Intronic
1158969957 18:62657105-62657127 AAGTCTGGTGAGGCCGGGCGCGG + Intergenic
1159068515 18:63595607-63595629 AATTATGTGAAGGCCGGGCGTGG + Intronic
1159819421 18:73120862-73120884 AAAAATGGGAAGGCCGGGCGCGG - Intergenic
1159901302 18:74049431-74049453 AAGTATGAAGAGGCTGGGCGCGG + Intergenic
1160140539 18:76317849-76317871 CAGTAAAGAGGGGCCGGGCGTGG + Intergenic
1160311605 18:77797301-77797323 TAGGATGTTGAGGCCGGGCGCGG + Intergenic
1160604807 18:80042014-80042036 CAGGAGTGAGAGGCCGGGCGCGG - Intronic
1160658944 19:289437-289459 CAGAATGGGCAGGCCCGGCGTGG + Intronic
1160664523 19:318764-318786 CAGTAAAAGGAGGCTGGGCGCGG + Intronic
1160794615 19:939405-939427 GTGTATCGAGAGGCCGGGCGCGG - Intronic
1160999110 19:1900400-1900422 AAGAAAGGGGAGGCCGGGCGCGG + Intergenic
1161066189 19:2239072-2239094 CTGTATTTGTAGGCCGGGCGTGG + Intronic
1161256945 19:3314896-3314918 CAGGAGGGGGCGGCCGGCCGAGG + Intergenic
1161376526 19:3941929-3941951 CAGCAAGAGGGGGCCGGGCGCGG - Intronic
1162085547 19:8246873-8246895 CATTGGGGGAAGGCCGGGCGCGG + Intronic
1162404505 19:10465508-10465530 GAGCAGGGGGAGGCTGGGCGCGG - Intronic
1162474956 19:10894251-10894273 CAGCATGGGAGGGCCGGGGGTGG + Intronic
1162719571 19:12654330-12654352 AAGGTTGGGGGGGCCGGGCGCGG - Intronic
1163142183 19:15357247-15357269 GGGGATGGGGTGGCCGGGCGTGG - Intronic
1163456628 19:17410045-17410067 AAGTAATGGAAGGCCGGGCGTGG - Intronic
1163563936 19:18038477-18038499 CAGCCTGGGCAGGCCAGGCGTGG - Intergenic
1163650976 19:18517539-18517561 CTGCATGGGATGGCCGGGCGTGG - Intronic
1163785262 19:19271819-19271841 CAGAAGGGGCAGGCCAGGCGTGG - Intronic
1164664777 19:30021234-30021256 CAGAAGGGGGAGGCCGGGTGTGG - Intergenic
1165172848 19:33906088-33906110 CGGTTCCGGGAGGCCGGGCGGGG + Intergenic
1165534794 19:36434742-36434764 ACGTATGGGGAGGCCGGGTGTGG + Intergenic
1165566133 19:36729919-36729941 CAGTGTGGTTAGGCCAGGCGTGG + Intronic
1165940063 19:39410439-39410461 CAGGATGGGGAGGCTGGAAGTGG - Intergenic
1166109513 19:40613678-40613700 CAGTGAGGGGGGGCGGGGCGTGG + Intronic
1166256969 19:41613557-41613579 CAGTATGGGGAGGACAGAGGGGG + Intronic
1166369061 19:42291413-42291435 CAGGATGGGGATGCCAGGAGTGG - Exonic
1166518948 19:43466513-43466535 AAGTAAATGGAGGCCGGGCGCGG + Intergenic
1166916977 19:46202048-46202070 CAGTGTGGGGAGGAGGGGAGAGG + Intergenic
1167456380 19:49598362-49598384 AAACATCGGGAGGCCGGGCGCGG - Intronic
1167908348 19:52680900-52680922 TATTTTGTGGAGGCCGGGCGCGG - Intronic
1168148401 19:54431927-54431949 CAGTAGGAGCTGGCCGGGCGCGG + Intronic
1168156199 19:54474093-54474115 CAGAATGGGGAAGCTGGGTGGGG + Intergenic
1168307420 19:55442983-55443005 GAGGCTGGGGAGGGCGGGCGGGG + Intergenic
1168317061 19:55489067-55489089 CAGAAGGGGGAGGCCTGGGGGGG - Intronic
925176341 2:1786712-1786734 CCGAATAGGAAGGCCGGGCGAGG + Intergenic
925370399 2:3340804-3340826 TAGAATGGGTAGGCCAGGCGCGG + Intronic
926077097 2:9950917-9950939 CAGCGTGGGGCGGCCGCGCGGGG + Intergenic
926870194 2:17407801-17407823 CAGCATGGGGAGCCTGGGCCAGG - Intergenic
927272296 2:21225143-21225165 TACTATTTGGAGGCCGGGCGCGG + Intergenic
927611248 2:24543403-24543425 CAGTGTTGGGAGGCAGGGCCTGG - Intronic
927777687 2:25915001-25915023 AAGAATGGGTAGGCCAGGCGTGG - Intergenic
928545911 2:32329006-32329028 AAAAATGGGGAGGCCGGGCATGG - Intergenic
928984847 2:37170946-37170968 TGGTATGGGGCGGCCGGGCGCGG + Intronic
929011509 2:37449843-37449865 CAAGAAGGGGAGGCAGGGCGTGG - Intergenic
929032724 2:37663882-37663904 CAGGCAGAGGAGGCCGGGCGCGG + Intronic
929180824 2:39036863-39036885 CAGCCTGGTCAGGCCGGGCGCGG - Intronic
930121091 2:47761377-47761399 CACTTTGGGGAGGCCGAGGGAGG + Intronic
930163318 2:48179873-48179895 AAGTATGAGGGGGCAGGGCGCGG + Intergenic
931507607 2:62948650-62948672 CAGTAAGGGGAGGCTGTGCTTGG - Exonic
931601773 2:64011275-64011297 AATTAAGGGGAGGCCGGGCACGG + Intronic
931726042 2:65111794-65111816 AATTATGAGGAGGCCAGGCGAGG + Intronic
932752858 2:74382780-74382802 AAATATGTGGAGGCCGGGCGCGG + Intronic
933137834 2:78759524-78759546 CAGTCTGGGGAGGAGGGGAGAGG - Intergenic
933432944 2:82207572-82207594 GAATATGCAGAGGCCGGGCGCGG - Intergenic
934099680 2:88641073-88641095 CAGTATGGGGAGGGAGCGTGTGG - Intergenic
935800437 2:106690268-106690290 CAGCATGGGGGTGCTGGGCGTGG + Intergenic
935822582 2:106909049-106909071 CAGTCTGGGGTGGCCTGGAGTGG - Intergenic
936102849 2:109598550-109598572 TATCATCGGGAGGCCGGGCGTGG + Intronic
936391705 2:112080547-112080569 AAGAATGGGCAGGCCGGGCGTGG - Intronic
936462579 2:112723714-112723736 CAGGATGGGGAGGCGTGGCTGGG - Exonic
936555736 2:113497625-113497647 AAGAATGAAGAGGCCGGGCGCGG + Intergenic
936699077 2:114988092-114988114 CAGTCTCCGGCGGCCGGGCGCGG - Intronic
937404489 2:121614203-121614225 AAGTGTGAGGAAGCCGGGCGCGG + Intronic
938267677 2:129940413-129940435 CAGAAGGGGGAGGATGGGCGGGG - Intergenic
939376964 2:141380950-141380972 CAATATGTGAAGACCGGGCGAGG + Intronic
940726529 2:157342193-157342215 CAGCCTGGGGAGGCTGGGAGAGG + Intergenic
940904637 2:159158063-159158085 CAGTGTAGAGAGGCCGGGCATGG + Intronic
941283547 2:163581699-163581721 TACTGGGGGGAGGCCGGGCGCGG - Intergenic
942649463 2:178151152-178151174 TGGTAGGTGGAGGCCGGGCGCGG - Intergenic
943309525 2:186309325-186309347 AAGTAAGTAGAGGCCGGGCGCGG + Intergenic
944250932 2:197579747-197579769 CAGTCTGGGGAGGAAGGGAGAGG - Intronic
945272662 2:207957406-207957428 CATTATGTGGTGGCTGGGCGCGG + Intronic
945877812 2:215296626-215296648 GAATACGTGGAGGCCGGGCGCGG + Intergenic
947247258 2:228062417-228062439 AGGTCTGGGGAGGCCGGGTGTGG - Intronic
947433529 2:230052223-230052245 AAGTATGTTTAGGCCGGGCGCGG - Intronic
947963289 2:234258021-234258043 AAGGATGGGAAGGCCGGGAGGGG + Intergenic
948737615 2:240019526-240019548 AAGAACGTGGAGGCCGGGCGCGG + Intronic
948884051 2:240874230-240874252 GGGAGTGGGGAGGCCGGGCGAGG + Intronic
1168943418 20:1732168-1732190 CAGTCTGGGGAGGAGGGGAGAGG + Intergenic
1169063665 20:2680081-2680103 GGCTATGAGGAGGCCGGGCGTGG - Intergenic
1169376104 20:5067729-5067751 CTGGGTGGGGAGGCCGGGTGTGG - Intergenic
1169693262 20:8357568-8357590 CACTCTGGGGGGGCCGAGCGAGG + Intronic
1169958530 20:11132679-11132701 CAGTTTGGGGAGGCCGAGGCTGG + Intergenic
1170569865 20:17626654-17626676 CAGTCTGGGGAGGCAGGTCCTGG - Intronic
1170708341 20:18766451-18766473 AAGAAGAGGGAGGCCGGGCGCGG + Intergenic
1171388864 20:24788179-24788201 CAGAAGGGGGAGGCTGGGGGGGG - Intergenic
1172254229 20:33502798-33502820 CAAGATTTGGAGGCCGGGCGCGG + Intronic
1172462059 20:35126620-35126642 TAAAATGGGGAGGCCAGGCGTGG + Intronic
1172509046 20:35487175-35487197 CACTCTTGGGAGGCCGCGCGTGG + Intronic
1172910800 20:38407643-38407665 CAGGATGGGGCGGCTGGCCGGGG - Intergenic
1173047718 20:39528518-39528540 AAGTGTGGGGAGGCTGGGAGTGG + Intergenic
1173695755 20:45010353-45010375 AATAATTGGGAGGCCGGGCGCGG - Intronic
1173788774 20:45813811-45813833 GATTAAGGGGAGGCTGGGCGCGG + Intronic
1173975936 20:47186647-47186669 ACGAATGAGGAGGCCGGGCGTGG - Intronic
1174121003 20:48265497-48265519 CGATATGGGGAGGCCTGGAGAGG - Intergenic
1174629880 20:51947088-51947110 GAGTAGGGGGTGGCCGGGCACGG + Intergenic
1174635779 20:51998295-51998317 GAGGAGGTGGAGGCCGGGCGCGG - Intergenic
1176006349 20:62865695-62865717 CAGAACTTGGAGGCCGGGCGCGG + Intergenic
1177362825 21:20095493-20095515 CAATATGGTAAGGCCGGGTGTGG - Intergenic
1177389036 21:20443026-20443048 AAGCAGGGAGAGGCCGGGCGCGG + Intergenic
1181000356 22:19985253-19985275 GAGTGCTGGGAGGCCGGGCGGGG - Intronic
1181144388 22:20833946-20833968 TAGTCTGGGTCGGCCGGGCGTGG - Intronic
1182421124 22:30249054-30249076 CAGGAGGGGGAGGCTGGGCCTGG - Intergenic
1183621273 22:38974288-38974310 AAGCAAGGGCAGGCCGGGCGCGG - Intronic
1183659648 22:39211652-39211674 AAGTCTGTGGCGGCCGGGCGCGG + Intergenic
1183731565 22:39621479-39621501 CAGTCTGGGCAGGCCTGGCGGGG + Intronic
1183887687 22:40898541-40898563 CAAAATGGGTCGGCCGGGCGCGG - Intronic
1184071073 22:42147400-42147422 CTGTAAGAGGAGGCCGGGTGTGG + Intergenic
1184566905 22:45297566-45297588 CTCTCTGGGGAGGCCGGGTGCGG - Intergenic
1185255005 22:49827245-49827267 GAAGACGGGGAGGCCGGGCGGGG - Intronic
949318752 3:2785896-2785918 CAGGATGGGGGGGCGGGGGGGGG - Intronic
949522839 3:4872427-4872449 AAGCCTGGGGAGGCCAGGCGTGG + Intronic
949601052 3:5598205-5598227 CAGGCCGGGCAGGCCGGGCGTGG + Intergenic
950043166 3:9933210-9933232 CAGGATGGGGTGTCCGGGCCCGG + Exonic
950811972 3:15657875-15657897 CAGTTGGAGGGGGCCGGGCGTGG + Intergenic
951652040 3:24961613-24961635 CACTGTGGGGAGGGAGGGCGGGG + Intergenic
951711010 3:25584899-25584921 AAGTAGGGGCAGGCCAGGCGGGG - Intronic
952328184 3:32339671-32339693 CTGCAGGGGTAGGCCGGGCGCGG + Intronic
952512680 3:34072805-34072827 CAGTGTGGGGAGCCAGGGCTTGG + Intergenic
952516783 3:34112490-34112512 CAGAATGGATCGGCCGGGCGCGG - Intergenic
953879567 3:46684609-46684631 CAGAATGGGGAGGACGTGGGAGG + Intronic
953980734 3:47411717-47411739 CAGTGTGGGGTGGCAGGGCAGGG + Intronic
954027380 3:47793931-47793953 CAGTAAGGGCTGGCCGGGTGCGG + Intergenic
954245882 3:49331029-49331051 AAATATTGGGAGGCCGGGCGTGG + Intronic
954710161 3:52501566-52501588 CAATGTGGGGAGGCTGGGTGGGG + Intronic
956518834 3:70081401-70081423 AACTATGAAGAGGCCGGGCGCGG - Intergenic
957451346 3:80386512-80386534 CAGTCTGGGGAGGAGGGGAGAGG - Intergenic
957985600 3:87570986-87571008 CAGTCTGGGGAGGAGGGGAGAGG - Intergenic
958025962 3:88049566-88049588 AAGTTTGGAGAGGCAGGGCGCGG + Intergenic
959137866 3:102447352-102447374 AAGGATGGGGAGGCCAGGTGTGG - Intronic
959448677 3:106471474-106471496 GAGTATGTGGAGGCTGGGCATGG - Intergenic
961130018 3:124457358-124457380 CAGAAGGGAGAGGCTGGGCGTGG - Intronic
961160306 3:124718409-124718431 CATAATGGGGAGGCCGGGCACGG - Intronic
961539982 3:127592673-127592695 CAGCATGTTGCGGCCGGGCGCGG - Intronic
961614777 3:128170134-128170156 CAGGCGGGGGAGGCGGGGCGGGG - Intronic
963093745 3:141512770-141512792 CAAAATAAGGAGGCCGGGCGTGG + Intronic
963337487 3:143993092-143993114 TAGTATTGTGAGGCCAGGCGCGG - Intronic
963891814 3:150644522-150644544 CACAATGGGCCGGCCGGGCGCGG + Intergenic
963947658 3:151163993-151164015 CGGCATGGGGAGGCTGGACGGGG - Exonic
964087108 3:152832198-152832220 AAGTAATGGCAGGCCGGGCGCGG + Intergenic
966339437 3:178909058-178909080 CAGAAAGGTGAGGCCGGGCGCGG + Intergenic
966416464 3:179694510-179694532 AGGAAAGGGGAGGCCGGGCGCGG + Intronic
966599567 3:181761686-181761708 AATTATGTGGAGGCCGGGCATGG + Intergenic
966711969 3:182980596-182980618 CAGTGCGGGGCGGCCCGGCGCGG + Exonic
966766064 3:183463741-183463763 GACTTTGGAGAGGCCGGGCGCGG - Intergenic
967184214 3:186931141-186931163 CAGTATGGGGTGGGGTGGCGTGG + Intronic
967553702 3:190830715-190830737 CACTTTGGGGAGGCCGAGGGAGG - Intergenic
967658204 3:192075134-192075156 CAGTCTGGGGAGGAGGGGAGAGG + Intergenic
967671269 3:192238334-192238356 CAGTAGGGGGAGGCTGAGGGTGG + Intronic
967876650 3:194272260-194272282 TAGTAGGGAGAGGCTGGGCGTGG - Intergenic
967922432 3:194623208-194623230 CAGAATTGTGAGGCCGGGGGTGG - Exonic
968037019 3:195556061-195556083 TTGAAGGGGGAGGCCGGGCGCGG - Intergenic
968177507 3:196563860-196563882 AAGTAGGGGGAGGCTGGGTGCGG - Intronic
968296094 3:197577578-197577600 CATTACAGGGAGGCCGGGGGAGG + Intergenic
968520338 4:1032192-1032214 CAGGAAGGAGAGGCCGGGCCAGG - Intergenic
969226842 4:5804226-5804248 AAGTAAAGTGAGGCCGGGCGAGG - Intronic
969408770 4:7014037-7014059 AAGTATCTGGAGGCCGGGTGCGG - Intronic
970842270 4:20488459-20488481 GAGAATGGGGAGACTGGGCGAGG - Intronic
971771026 4:30897192-30897214 AAGAACTGGGAGGCCGGGCGCGG - Intronic
972119332 4:35681150-35681172 AAGAATGTTGAGGCCGGGCGCGG + Intergenic
972321666 4:37977709-37977731 CCCTGTGGGGAGGACGGGCGAGG + Intronic
972393461 4:38635093-38635115 CAGGTTGGGGAGGCCGGGTGCGG + Intergenic
974692047 4:65308767-65308789 TAGTATGTGAAGGCCAGGCGCGG + Intergenic
974754013 4:66180369-66180391 CAGCATGGGCAGGACAGGCGCGG + Intergenic
976228708 4:82817915-82817937 CAGTGTGGTAAGGCCGGGCGCGG - Intergenic
978198473 4:105997706-105997728 AAGGATTTGGAGGCCGGGCGCGG + Intronic
978571460 4:110142333-110142355 TAGTAAGGGGTGGCCGGGTGCGG - Intronic
980683446 4:136194018-136194040 TAGTATGGGTAGGCCAGGCACGG - Intergenic
980915706 4:139031437-139031459 CACTCAGGGCAGGCCGGGCGTGG - Intronic
980986500 4:139700419-139700441 CAGTACCTGGTGGCCGGGCGTGG - Intronic
981780509 4:148424001-148424023 CTGTATTGGTAGGCTGGGCGTGG - Intronic
982936347 4:161482028-161482050 ATGTATGTGCAGGCCGGGCGTGG + Intronic
983559335 4:169085486-169085508 GAGCATGGGCAGGCCGGGTGTGG + Intergenic
983945610 4:173583085-173583107 AAGAATTGTGAGGCCGGGCGCGG + Intergenic
984404740 4:179313541-179313563 ATGTTTGGGCAGGCCGGGCGCGG + Intergenic
985126873 4:186703172-186703194 CAGAGTGGGGATGGCGGGCGTGG - Intronic
985204001 4:187513867-187513889 AAGTGAGGTGAGGCCGGGCGCGG - Intergenic
985713754 5:1444854-1444876 CAGGGCGGGGAGGCCGGGCGAGG - Intronic
986366787 5:7040805-7040827 CAGTATGGGGAGGTGGGAAGGGG + Intergenic
986367290 5:7045152-7045174 CACTTTGGGGAGGCCGAGCGGGG - Intergenic
986369070 5:7062358-7062380 CAGTCTGGGGAGGAGGGGAGAGG + Intergenic
987819273 5:22941074-22941096 CATGTTGGGGAGGCCAGGCGCGG - Intergenic
987839233 5:23201433-23201455 AAGAATCGGGAAGCCGGGCGCGG + Intergenic
988139595 5:27218609-27218631 AGATATGGGCAGGCCGGGCGCGG + Intergenic
988271688 5:29025378-29025400 CTGTATGGGCAGGCAGGGTGCGG - Intergenic
988409157 5:30864245-30864267 GAGTGGGAGGAGGCCGGGCGCGG + Intergenic
988961481 5:36375659-36375681 AAGAATTAGGAGGCCGGGCGCGG + Intergenic
989478484 5:41901551-41901573 AAAGATGGGTAGGCCGGGCGCGG - Intergenic
992283180 5:75203371-75203393 CCCAAAGGGGAGGCCGGGCGCGG + Intronic
992769637 5:80035301-80035323 CTTTATGGTGCGGCCGGGCGGGG - Intronic
993178285 5:84516998-84517020 AAGAATGTTGAGGCCGGGCGTGG + Intergenic
993338572 5:86692876-86692898 CAGTATGGGGAGGCTGAGGCAGG - Intergenic
993504715 5:88694868-88694890 CACTTTTGTGAGGCCGGGCGCGG + Intergenic
994664051 5:102687413-102687435 AAGAATGTTGAGGCCGGGCGCGG + Intergenic
994872291 5:105367131-105367153 GAAAATGAGGAGGCCGGGCGTGG - Intergenic
996928834 5:128861526-128861548 AAGTAAGGAGAGGCCGGGCGCGG - Intronic
997975443 5:138439192-138439214 CACCATGGCGGGGCCGGGCGCGG - Exonic
998469217 5:142370323-142370345 AAATATGTGAAGGCCGGGCGTGG - Intergenic
999438675 5:151584268-151584290 CTGTGTGGGCAGGCCGGGCAGGG - Intergenic
1000343887 5:160298202-160298224 GACTATGTTGAGGCCGGGCGTGG + Intronic
1003304725 6:4916013-4916035 CAGGATGGGGTGGCGGGGTGGGG - Intronic
1003353269 6:5340855-5340877 ATGGATGAGGAGGCCGGGCGCGG + Intronic
1003925255 6:10871552-10871574 CAGGATGGGGAGGAAGGGCCGGG - Intronic
1004225427 6:13780396-13780418 CAGTCTGGGCATGCCGGGCGTGG + Intergenic
1005621929 6:27628347-27628369 CAGTTTTGGGATGCCGGGTGGGG - Intergenic
1005634557 6:27740910-27740932 GAGCATAAGGAGGCCGGGCGCGG + Intergenic
1005637001 6:27762216-27762238 CGGGAGGAGGAGGCCGGGCGCGG - Intergenic
1005960246 6:30688659-30688681 CAGGATGGGGAGGCAGAGTGAGG - Exonic
1006235923 6:32632046-32632068 TAATATGAGGAGGCCAGGCGCGG - Intronic
1006294014 6:33161803-33161825 AAGTACGGGGAGGAGGGGCGGGG + Intergenic
1006964987 6:37974308-37974330 CAGTCTGGGGAGGCCGAGGAGGG - Intronic
1007248955 6:40482749-40482771 CAGGAGGGGGAGGCAGGGCCTGG - Intronic
1007444029 6:41890420-41890442 AAGTATTAGGAGGCCAGGCGCGG + Intronic
1007654584 6:43444654-43444676 CAGGGTGGGGAGGCCAGGCCAGG + Intronic
1008514619 6:52307370-52307392 GAGAGTGGGGAGGCCGGGAGAGG - Intergenic
1008846189 6:55966855-55966877 CACTTTGGGGAGGCCGGGGCGGG - Intergenic
1009750112 6:67871331-67871353 CAGTCTGGGGAGGAGGGGAGAGG - Intergenic
1009750401 6:67873030-67873052 CAGTCTGGGGAGGAGGGGAGAGG + Intergenic
1010147520 6:72688081-72688103 CAGTATTGGGAGGCCGAGGCAGG - Intronic
1010641795 6:78337501-78337523 AAGAATGTGGAAGCCGGGCGTGG - Intergenic
1010660844 6:78569342-78569364 GAGTTTGGGGGGGCCGGGCACGG - Intergenic
1010795894 6:80115880-80115902 CAGCATTGGGAGGCCGAGGGGGG - Intronic
1012116372 6:95303488-95303510 AAGATTTGGGAGGCCGGGCGCGG - Intergenic
1012398301 6:98824623-98824645 GGGGATGGGGAGGCGGGGCGGGG - Intergenic
1013103979 6:107010848-107010870 GAGTAGGGGTTGGCCGGGCGCGG + Intergenic
1013225815 6:108118728-108118750 CTGTATGGGGAGGCCAGGGGTGG - Intronic
1013924403 6:115450927-115450949 CAGCTTGGGGCGGCCGGGCGCGG - Intergenic
1014436601 6:121427532-121427554 CAGTTAGGTTAGGCCGGGCGCGG + Intergenic
1014656605 6:124113614-124113636 CAGGGTGGGGAGTCGGGGCGGGG - Intronic
1015323738 6:131903341-131903363 CAGTCTGGGGAGGAAGGGAGAGG - Intergenic
1015343696 6:132131166-132131188 TAGTCTGGGGAGGCCAGGCCAGG + Intergenic
1015405911 6:132836595-132836617 AAGAAAGTGGAGGCCGGGCGCGG - Intergenic
1015922804 6:138282243-138282265 CAGTCTGGGGAGGGTGGGTGCGG - Intronic
1016069227 6:139718501-139718523 AAGTATGAGTAGGCCGGGCGCGG - Intergenic
1016093427 6:140007017-140007039 AAATATGAGCAGGCCGGGCGGGG + Intergenic
1016474025 6:144406655-144406677 ATGGAAGGGGAGGCCGGGCGTGG - Intronic
1016878498 6:148887357-148887379 AGGCATGGGGAGGCCGGGTGTGG - Intronic
1017671948 6:156777650-156777672 CGGCGTGGCGAGGCCGGGCGGGG - Intergenic
1017696676 6:157022131-157022153 CAGGGCGGGGAGGCGGGGCGGGG + Intronic
1018088540 6:160325911-160325933 CAGGGTGGGGGGGCCGGCCGGGG - Intergenic
1018908075 6:168086720-168086742 CAGTATGGGGATGCCGAGGGGGG - Intergenic
1019560510 7:1654216-1654238 CTGGATGGGCAGGCAGGGCGGGG - Intergenic
1019733141 7:2638350-2638372 CACGAGGGGGAGGGCGGGCGTGG + Intronic
1020138530 7:5599519-5599541 CAGGATGGGGAGGCCGGGCGTGG + Intronic
1020351730 7:7227428-7227450 AAGAAAGGGAAGGCCGGGCGCGG + Intronic
1020868236 7:13592326-13592348 CTTTATGGGAGGGCCGGGCGCGG - Intergenic
1021036871 7:15810117-15810139 CAGCATGGGGAGCCTGGGCCTGG + Intergenic
1021172570 7:17415424-17415446 CAGTCTGGGGAGGAGGGGAGAGG - Intergenic
1021963574 7:25895624-25895646 CAGTGCGGGGGCGCCGGGCGTGG - Intergenic
1022412021 7:30146443-30146465 CAGTATAGGGAGGCCGAGGGCGG + Intronic
1022565092 7:31391544-31391566 TAGGATGGTTAGGCCGGGCGTGG + Intergenic
1022944672 7:35270524-35270546 CAGTAGGGGTTGGTCGGGCGCGG + Intergenic
1024247923 7:47484486-47484508 CAGGATGAGGCGGCCGGGCTGGG + Intronic
1025843758 7:65176730-65176752 AAGCACAGGGAGGCCGGGCGCGG - Intergenic
1026012058 7:66644241-66644263 GAGAATGGGGAGGCCAGGCATGG + Intronic
1026041147 7:66869199-66869221 AAGAATGGAGGGGCCGGGCGCGG - Intergenic
1026169400 7:67940610-67940632 GAGTACGTGGTGGCCGGGCGCGG - Intergenic
1027543714 7:79500262-79500284 CAGAAAGGGAGGGCCGGGCGCGG - Intergenic
1028397937 7:90392826-90392848 AAGAATCTGGAGGCCGGGCGCGG + Intronic
1028576889 7:92362099-92362121 AAGTGTGTAGAGGCCGGGCGTGG - Intronic
1029131366 7:98333730-98333752 TAGTTTGGGGAGGGTGGGCGGGG - Intronic
1029400675 7:100343688-100343710 AAGTAAAGGGTGGCCGGGCGCGG - Intronic
1030138898 7:106285201-106285223 CAGTGCGCGGAGGCGGGGCGGGG + Intronic
1030376212 7:108756015-108756037 CAGTATGGGGAGGGAGGGTACGG - Intergenic
1031097798 7:117441789-117441811 AATAATGTGGAGGCCGGGCGCGG - Intergenic
1031364840 7:120889698-120889720 CAGTCTGGGGAGGAGGGGAGAGG + Intergenic
1031523515 7:122795838-122795860 CAGTATGGGAAGTCCTGGCCAGG + Intronic
1031963079 7:128007066-128007088 CAGTATGCGGATGCCAGGCCTGG + Intronic
1032163454 7:129527621-129527643 AAGTATGGAGAGGCTGGGCGTGG - Intergenic
1032194480 7:129781170-129781192 CCGTCTGGGGCGGCCGGGCGGGG - Intergenic
1032937303 7:136747756-136747778 AAGAAAAGGGAGGCCGGGCGCGG + Intergenic
1033158471 7:138976349-138976371 CGTTATGTTGAGGCCGGGCGCGG - Intronic
1034643464 7:152623761-152623783 AAGTATGTGGTGGCCAGGCGCGG - Intergenic
1035068841 7:156126378-156126400 CAGTGTTGGGAGGCCGAGCTTGG + Intergenic
1035558618 8:588077-588099 AAGAATGTTGAGGCCGGGCGCGG + Intergenic
1036110193 8:5890655-5890677 AAAAATGGAGAGGCCGGGCGCGG + Intergenic
1037296561 8:17408098-17408120 CATCATGGAGAGGCCGGGCGCGG + Intronic
1038492711 8:27982047-27982069 AGGAATGGGGAGGCCGGGCCTGG + Intronic
1038771871 8:30490100-30490122 CAGTATACAGAGGCTGGGCGTGG - Intronic
1039858752 8:41438432-41438454 CAGTGAGGGGAGGTCGGGCTGGG + Intergenic
1039873603 8:41567375-41567397 CAGCAGGAGGAGGCCGGGCCGGG - Intergenic
1040501894 8:48012426-48012448 AAGTATGTGCAGGCCGGGTGGGG + Intronic
1040647922 8:49421104-49421126 CAGTCTGGGGAGGAGGGGAGAGG - Intergenic
1042917004 8:73885300-73885322 GAGTCTGGGCAGGCCAGGCGCGG + Intergenic
1043032423 8:75153665-75153687 AAGTATATGGAGGCCGGGCATGG + Intergenic
1043104448 8:76090139-76090161 CAGTGTGGGCAGGCAGGGAGGGG - Intergenic
1043720748 8:83545039-83545061 CAGTCTGGGGAGGAGGGGAGAGG - Intergenic
1045893471 8:107185388-107185410 AAGCATGGGCAGGCCGGGCATGG - Intergenic
1046042046 8:108917612-108917634 CAGGTTGGAGAGGCCGGGTGCGG + Intergenic
1046863293 8:119118456-119118478 CAGTGTGGGGTGGCCTGGTGGGG - Intergenic
1047191472 8:122682732-122682754 AAGAATTTGGAGGCCGGGCGCGG + Intergenic
1047525936 8:125634087-125634109 CAGTGAGGGGAGGGCGGGTGGGG - Intergenic
1047656193 8:126979898-126979920 GAGCATGTGGGGGCCGGGCGCGG - Intergenic
1048064890 8:130957666-130957688 CAGTATGGGGACCCTGGGCCTGG - Intronic
1048669624 8:136703175-136703197 GAGTTTGAGGTGGCCGGGCGCGG - Intergenic
1049195840 8:141315229-141315251 CAGGATGGGGAGGAGGGGCAGGG + Intergenic
1049468768 8:142765668-142765690 AAGAATGTGTAGGCCGGGCGCGG + Intronic
1049727456 8:144155239-144155261 CAGTATTGAGAGGCCGGGTGCGG - Intronic
1049897295 9:119724-119746 AAGAATGAAGAGGCCGGGCGTGG - Intergenic
1050436367 9:5614762-5614784 CAGTGAGGGGTGGCTGGGCGTGG - Intergenic
1050497718 9:6262319-6262341 AAGAATGTTGAGGCCGGGCGCGG + Intergenic
1050756339 9:9008514-9008536 AATGAAGGGGAGGCCGGGCGCGG - Intronic
1050826247 9:9950432-9950454 AAGAAAGTGGAGGCCGGGCGCGG + Intronic
1051412054 9:16799932-16799954 AACTATGTAGAGGCCGGGCGCGG + Intronic
1052897716 9:33763407-33763429 AAGAAGGTGGAGGCCGGGCGTGG + Intronic
1053134054 9:35638300-35638322 CAGTCTGGGGAGGAGGGGAGAGG - Intronic
1053266743 9:36720684-36720706 CAGGATGGAGAGGCGGGGCGCGG + Intergenic
1054688908 9:68306867-68306889 CAGTGTGGGGGGGGGGGGCGGGG - Intergenic
1055055676 9:72021804-72021826 GAGAATAGGTAGGCCGGGCGCGG - Intergenic
1055065772 9:72116673-72116695 AAACCTGGGGAGGCCGGGCGCGG - Intronic
1055119146 9:72638160-72638182 TAGTATGGGCAGGCTGGGGGCGG - Intronic
1056349716 9:85737860-85737882 CAGGGTGGGGAGGCCGGGGAGGG - Intronic
1056388227 9:86116872-86116894 CAGTTTTGGGAGGCTGGGCCTGG + Intergenic
1056807202 9:89738062-89738084 CTGTATGGGGAAGCCAGGCATGG + Intergenic
1056944770 9:90984944-90984966 CAGCATGGGGGGGCCAGGCACGG + Intergenic
1057302412 9:93894525-93894547 CAGGCTGGGAAGGCCGGGCCTGG + Intergenic
1057725453 9:97564989-97565011 GAGCATGGGGAGGCCAGGTGGGG - Intronic
1058162136 9:101581227-101581249 CAGGATGGGGAGGTTGGGTGGGG + Intronic
1058539398 9:105995758-105995780 CAGGATGGGGACGCTGGGCCAGG + Intergenic
1058588108 9:106532132-106532154 CAGCATGGGGATGCAGGGTGTGG - Intergenic
1059011961 9:110470724-110470746 CAGTAAGTGGAGGCCAGGCTCGG - Intronic
1059249519 9:112876322-112876344 CAGAATATGGAGGCTGGGCGTGG + Intronic
1059441861 9:114312265-114312287 CAGGCTGGGGCGGCAGGGCGAGG - Exonic
1059535608 9:115077478-115077500 TATGATGAGGAGGCCGGGCGTGG - Intronic
1059702594 9:116790214-116790236 AAGTAAGGGTAGGCCGGGTGTGG - Intronic
1060063331 9:120481205-120481227 CAGGATGGTGAGGCCAGGTGTGG + Intronic
1060275006 9:122175822-122175844 GAGCAAGGAGAGGCCGGGCGCGG + Intronic
1060677109 9:125525381-125525403 AAGTAACAGGAGGCCGGGCGCGG + Intronic
1061003733 9:127916841-127916863 ACGAATGGAGAGGCCGGGCGAGG + Exonic
1061047732 9:128176222-128176244 CAGTGTGAGGAGGCCTGGCTGGG + Intronic
1061343958 9:130006941-130006963 AAGAATGTGGAGGCCGGGTGCGG + Intronic
1061405028 9:130388952-130388974 CAGAATGGGGAGGCCTGGATGGG - Intronic
1061576879 9:131512900-131512922 GTGTATGAGGGGGCCGGGCGTGG - Intronic
1061691404 9:132335098-132335120 AAGTATTTTGAGGCCGGGCGTGG + Intronic
1062432703 9:136533102-136533124 CCAGGTGGGGAGGCCGGGCGGGG - Intronic
1062494484 9:136825372-136825394 CAGTATGCTGAGGCCAGGAGGGG + Intronic
1186054073 X:5630096-5630118 AAGTATAGCTAGGCCGGGCGTGG - Intergenic
1186788703 X:12976044-12976066 AAATATGGGGAGGAGGGGCGCGG + Exonic
1187507583 X:19889140-19889162 AAGAATGTGAAGGCCGGGCGCGG + Intergenic
1187873490 X:23783563-23783585 CGGAATGGGGCGGGCGGGCGGGG - Intronic
1188292868 X:28410357-28410379 AAGATTGGGGAGGCCGGGCGTGG + Intergenic
1188577973 X:31675649-31675671 AAGAATGGTGAGGCCGGGCGCGG - Intronic
1188748821 X:33880804-33880826 AAGCATGATGAGGCCGGGCGCGG - Intergenic
1189031914 X:37459889-37459911 CAGTCTGGGGAGGAGGGGAGAGG + Intronic
1189781775 X:44521163-44521185 GAGTATATGGAGGCTGGGCGTGG - Intergenic
1190087123 X:47405095-47405117 AAGAAGGGGGAGGCCGGACGTGG + Intronic
1190108573 X:47575071-47575093 TAGTGTGGGGAGGCCGGCCCTGG - Intronic
1190941083 X:55041726-55041748 CAGTAGGGGTAGGCTGGGAGCGG + Intergenic
1191844917 X:65539957-65539979 AAGTAAAGGAAGGCCGGGCGCGG - Intergenic
1191869864 X:65736724-65736746 AAGCCTGGGGAGGCCAGGCGCGG - Intronic
1192346989 X:70318166-70318188 AAGCAAGGGGAGGCCGGGCATGG - Intronic
1192425304 X:71069648-71069670 CAGCATATGCAGGCCGGGCGCGG + Intronic
1193747490 X:85299576-85299598 CAGGAGGTGGAGGCTGGGCGCGG - Intronic
1194367011 X:93024590-93024612 CAGTCTGGGGAGGAGGGGAGAGG - Intergenic
1195297216 X:103490669-103490691 TAGTCAGGGGTGGCCGGGCGCGG - Intergenic
1195318317 X:103700205-103700227 TAGTATGAGGAGGCCGGGCACGG + Intergenic
1195458730 X:105099754-105099776 AAGTGTGTGGCGGCCGGGCGCGG - Intronic
1195903069 X:109818485-109818507 GAAAAAGGGGAGGCCGGGCGCGG - Intergenic
1196908750 X:120465031-120465053 CACTATGAAGAGGCCGGGCATGG - Intronic
1197499623 X:127228215-127228237 CAGCATGGGGAGGAGGGGAGAGG - Intergenic
1197606794 X:128594568-128594590 AAGTAAAGAGAGGCCGGGCGCGG - Intergenic
1198565527 X:137900920-137900942 CAAAATGAGTAGGCCGGGCGCGG - Intergenic
1199320054 X:146427365-146427387 AAGGAGGAGGAGGCCGGGCGCGG - Intergenic
1200105959 X:153712581-153712603 AAGCATGTGGAGGCTGGGCGTGG + Intronic
1200675233 Y:6140846-6140868 CAGTCTGGGGAGGAGGGGAGAGG - Intergenic
1201724908 Y:17140760-17140782 CAGTCTGGGGAGGAGGGGAGAGG + Intergenic