ID: 1068783139

View in Genome Browser
Species Human (GRCh38)
Location 10:60943593-60943615
Sequence CCAGTATGGGGAGGCCGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 264}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068783139_1068783152 6 Left 1068783139 10:60943593-60943615 CCCGCCCGGCCTCCCCATACTGG 0: 1
1: 0
2: 1
3: 25
4: 264
Right 1068783152 10:60943622-60943644 AAGGGGAAGCGCCTTCTCGTCGG No data
1068783139_1068783155 28 Left 1068783139 10:60943593-60943615 CCCGCCCGGCCTCCCCATACTGG 0: 1
1: 0
2: 1
3: 25
4: 264
Right 1068783155 10:60943644-60943666 GCGCGGCACCACCCCCTCCCTGG No data
1068783139_1068783153 11 Left 1068783139 10:60943593-60943615 CCCGCCCGGCCTCCCCATACTGG 0: 1
1: 0
2: 1
3: 25
4: 264
Right 1068783153 10:60943627-60943649 GAAGCGCCTTCTCGTCGGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068783139 Original CRISPR CCAGTATGGGGAGGCCGGGC GGG (reversed) Intronic
900091878 1:924251-924273 GCAGTCCGGGGAGGCCTGGCGGG + Intergenic
900209958 1:1450541-1450563 GGAGGATGGGGAGGCAGGGCTGG + Exonic
900220013 1:1503445-1503467 GGAGGATGGGGAGGCAGGGCTGG + Intergenic
900222320 1:1515872-1515894 GGAGGATGGGGAGGCAGGGCTGG + Intronic
900237863 1:1601026-1601048 CCAGTTAGGGCAGGCCGGCCAGG - Intergenic
900516664 1:3085432-3085454 CCAGAATGGGGAGCCCTGGGGGG - Intronic
901064035 1:6486221-6486243 CCAGAAGGGGGAGGCCAGGATGG + Intronic
901344802 1:8530492-8530514 CCAAAATGGGGAGGCGGGGCGGG + Intronic
902870016 1:19308305-19308327 CCAGGAAGGGGAGGCCAGGGTGG + Intronic
903233526 1:21935998-21936020 CCAGGAAGGTGAGGCCAGGCAGG + Intronic
903257524 1:22112893-22112915 CCTGTATGGGGAGGAGGGGTAGG + Intergenic
903368356 1:22818599-22818621 GCAGAATGGGAAGGCTGGGCCGG - Intronic
903378916 1:22883665-22883687 ACAGAGTGGGAAGGCCGGGCTGG - Intronic
903730922 1:25494663-25494685 TAAGTATGGGGAGGGCGGACGGG + Intronic
903788259 1:25875454-25875476 CCAAGACGGGGAGGCCTGGCTGG - Intergenic
904379896 1:30103518-30103540 CCAGCAGGTGAAGGCCGGGCAGG + Intergenic
905273946 1:36805224-36805246 CCGGTATGGGGAGCCTGAGCAGG + Exonic
906107742 1:43304921-43304943 CGTGTCTGGGGAGGCCGGGGCGG + Exonic
906130734 1:43453791-43453813 CATGCCTGGGGAGGCCGGGCCGG + Exonic
907278787 1:53331647-53331669 CCAGGATGGAGAGGCAGGGTAGG - Intergenic
909478805 1:76112038-76112060 CCCGGATGGGGAGGCTGGCCGGG + Intronic
911223535 1:95278095-95278117 CCAGTATGAGGAAGCAGTGCTGG + Intergenic
913016535 1:114742339-114742361 CCAGCACAGGGAGGCCGGGGTGG + Intronic
914888287 1:151601040-151601062 CCCGGATGGGGCGGCCGGCCGGG - Intergenic
915910336 1:159910958-159910980 GCAGCATGGGGAGGCCCAGCAGG + Intergenic
916037897 1:160936839-160936861 CCCGGATGGGGAGGCTGGCCGGG + Intergenic
920118219 1:203636326-203636348 TCAGGATGGGGAGGCGGGGGTGG - Intronic
920171229 1:204073561-204073583 CCGGGTTGGGGAGGCTGGGCTGG - Intronic
920245710 1:204585882-204585904 CCAACATGGGGAGCCCGGGCTGG + Intergenic
922717368 1:227884598-227884620 CCCGTGTGGAGAGGCGGGGCAGG + Intergenic
922720028 1:227895628-227895650 CCAGGATGGCGAGACCAGGCTGG + Intergenic
922746807 1:228048831-228048853 CCTGTCTGGGGAAGCCTGGCTGG + Intronic
924590768 1:245402072-245402094 GCAGTAGGGTGAGGCTGGGCTGG + Intronic
1063696096 10:8336549-8336571 CCTGTTTGGGGAGGCCGAGAGGG + Intergenic
1065261267 10:23926035-23926057 TCAGTATGGGGAGGTCTGCCTGG - Intronic
1066140478 10:32500201-32500223 CCCGGATGGGGCGGCCGGCCTGG + Intronic
1067710554 10:48648267-48648289 GGAGTATGGGAAGGCAGGGCAGG + Intronic
1067839773 10:49666292-49666314 CCAGCATGGGCAGGACAGGCAGG + Intergenic
1068044687 10:51871427-51871449 TCAGGATGGGGAGGCCAGGCTGG - Intronic
1068783139 10:60943593-60943615 CCAGTATGGGGAGGCCGGGCGGG - Intronic
1069959368 10:72070558-72070580 GCAGTGTGGGGAGGGTGGGCAGG - Intronic
1070324322 10:75378081-75378103 CCAGGCAGGGGAGGCCGGGGAGG + Intergenic
1070695215 10:78558073-78558095 CCAGTATGGGGAGGCCTTGAAGG - Intergenic
1072451741 10:95544337-95544359 CCAGTCTTGGGAGGGCTGGCTGG - Intronic
1072602128 10:96940992-96941014 CCCGGATGGGGCGGCCGGCCGGG + Intronic
1073181686 10:101587495-101587517 CCAGTTTGGGGAAGCGGGTCGGG + Intronic
1074703127 10:116109735-116109757 CCAGTAGGGGCTGGCCTGGCCGG + Intronic
1075637249 10:124037656-124037678 CCACTATGGGGCGGCCTGGCTGG - Intronic
1075709205 10:124521677-124521699 GCAGCATGGGGAGGCCGTCCAGG + Intronic
1075962876 10:126584580-126584602 CCTGAATGGGAAGGCCAGGCTGG - Intronic
1076171145 10:128321146-128321168 CCTGGGTGGGGAGGCAGGGCTGG - Intergenic
1076481831 10:130789707-130789729 CAGCTATGGGGAGGCTGGGCTGG + Intergenic
1076634788 10:131875246-131875268 CCTGGCTGGGGAGGGCGGGCAGG - Intergenic
1076750779 10:132541791-132541813 ACAGTATGGGGAGGGAGGACTGG - Intronic
1077229019 11:1450455-1450477 CCAGTGGCGGGAGGCCGGGCTGG - Intronic
1077339075 11:2018029-2018051 CCATTCTGGGGAGCCTGGGCGGG + Intergenic
1077435714 11:2538265-2538287 CCAAGAAGGGAAGGCCGGGCAGG - Intronic
1078527322 11:12110750-12110772 TCAGGGTGGGGAGGGCGGGCGGG + Intronic
1078947425 11:16085252-16085274 CCAGTATGGTGAGGACTGGTTGG + Intronic
1079115125 11:17635704-17635726 CCAGTGTGGTGAGTCCTGGCTGG + Exonic
1079444994 11:20548929-20548951 CCCGGATGGGGCGGCCGGCCGGG - Intergenic
1083860202 11:65416365-65416387 CCAGAATGGGGGTGCAGGGCTGG + Intergenic
1084277824 11:68064157-68064179 CCAGCATGGGAAGGCCGAGCTGG + Intronic
1084861701 11:72023028-72023050 CCAGACTGGGGAGGCAGGGCAGG - Intronic
1084960677 11:72714623-72714645 CCAGAATGGGGAGTCAGGGAAGG + Intronic
1085013479 11:73157506-73157528 CAAGGATTGGGAGGCAGGGCTGG + Intergenic
1086572572 11:88302374-88302396 CCAGCATTGGGAGGCCGAGGCGG + Intronic
1086881545 11:92157814-92157836 CCCGTATGGGGCGGCTGGCCGGG - Intergenic
1089538227 11:119173660-119173682 CCAGTGGGGGGAGCCCGGCCTGG - Exonic
1089625472 11:119748326-119748348 CCAGGATGGGAAGGCAGGGCGGG - Intergenic
1090075441 11:123577712-123577734 CCAGTGAGGTGAGGCGGGGCAGG + Intronic
1090884157 11:130861593-130861615 CCAGCCTGGGGAAGCTGGGCGGG - Intergenic
1090917668 11:131180150-131180172 CCAGGATGGTGACGCTGGGCAGG - Intergenic
1091140265 11:133228589-133228611 CTAGGACGGGGAGGCCCGGCAGG - Intronic
1202822059 11_KI270721v1_random:73211-73233 CCATTCTGGGGAGCCTGGGCGGG + Intergenic
1091552396 12:1546501-1546523 CCAGTAGGGGCAGTCAGGGCGGG - Intronic
1092182801 12:6457647-6457669 CCTGTATAGTGAGGCCGGGCAGG - Exonic
1092242804 12:6845850-6845872 ACAGAATGGGGAGGGAGGGCTGG - Intronic
1095049871 12:37545882-37545904 CCAGTAGGGGGCGGCAGGGGAGG - Intergenic
1097126836 12:56783241-56783263 CCCGGACGGGGTGGCCGGGCGGG + Intronic
1097126955 12:56783511-56783533 CCCGGATGGGGCGGCCGGCCGGG + Intronic
1097127791 12:56789056-56789078 CCCGGACGGGGCGGCCGGGCGGG + Intergenic
1100995083 12:100294480-100294502 CCAGGATGGGGCGGCTGGCCAGG + Intronic
1101978466 12:109383831-109383853 CCAGTATGTGGAGTCGGGGTGGG - Intronic
1102673367 12:114638799-114638821 CCAGCATTGGGAGGCCGAGGCGG - Intergenic
1103692951 12:122790701-122790723 CCAGGAAGGGGAGGGAGGGCTGG - Intronic
1104554909 12:129790617-129790639 ACAGGATGGGGGGGCAGGGCAGG + Intronic
1104837332 12:131800052-131800074 TCAGCATGGTGAGGCGGGGCTGG - Intergenic
1105896138 13:24718637-24718659 CCGGCATGGGAAGGCAGGGCTGG + Intergenic
1106115956 13:26817906-26817928 GCAGATTGGGGAGGCAGGGCTGG + Intergenic
1107854256 13:44599263-44599285 CCAGTTTTGGGAGGCTGGGGTGG - Intergenic
1111388629 13:87561855-87561877 CCCAGATGGGGCGGCCGGGCAGG - Intergenic
1112574036 13:100619188-100619210 CCTGGATGGGGCGGCCGGCCGGG + Intronic
1113772103 13:112916949-112916971 CCAGTGTGGGGAGAGCGTGCAGG - Intronic
1113785910 13:113002035-113002057 ACAGTGCGGGGACGCCGGGCGGG + Intronic
1113916746 13:113878445-113878467 CCAGTATTGGGAGGACGAGGTGG - Intergenic
1114644984 14:24250599-24250621 CCAGGGTGGGGAGGCAGAGCTGG - Intronic
1115664644 14:35534092-35534114 CCAGCCCGGGGAGGCCCGGCGGG + Exonic
1117257933 14:53999393-53999415 CCAGTGTGAAGTGGCCGGGCTGG - Intergenic
1119594898 14:75925059-75925081 CCAGGATGGGGCGGCTGGTCGGG + Intronic
1122348120 14:101072832-101072854 GCTGGATGGCGAGGCCGGGCAGG + Intergenic
1122367473 14:101202705-101202727 CCAGCATGGGGAGGCACAGCCGG + Intergenic
1122748770 14:103917677-103917699 CAAGAATGGGGAGGCCAGGCCGG + Intronic
1122784033 14:104155744-104155766 TCAGTGTGGGGAGGCCCAGCTGG + Intronic
1122809538 14:104281200-104281222 CCAGCATGGGATGGCGGGGCTGG + Intergenic
1122941784 14:104984760-104984782 CCAGTCTGGGAAGGCCAGGGAGG + Intergenic
1122996127 14:105265648-105265670 GCAGTATTGGGAGGCCGAGGCGG + Intronic
1123039111 14:105483183-105483205 CCAGTCTGTGGAAGCCAGGCAGG + Intergenic
1125957884 15:43803139-43803161 GCACTTTGGGGAGGCTGGGCTGG + Intergenic
1126573250 15:50173049-50173071 CCCGGATGGGGAGGCTGGCCGGG - Intronic
1128979253 15:72174805-72174827 CAAGAATGGGGAGACAGGGCAGG + Intronic
1129161822 15:73751964-73751986 CCAGCCTGGGCAGGCCTGGCTGG - Intronic
1129424480 15:75454189-75454211 CGCCTATCGGGAGGCCGGGCTGG - Intronic
1129803870 15:78438272-78438294 GAAGAAGGGGGAGGCCGGGCAGG - Exonic
1130071163 15:80647717-80647739 CCAGGATGGGGCGGCTGGCCGGG - Intergenic
1130960606 15:88656357-88656379 CCTGTATGGGGAGGAGGGTCTGG + Exonic
1132245989 15:100296757-100296779 CCAGGGTAGGGAAGCCGGGCTGG + Intronic
1132588752 16:717276-717298 CCGCTTTGGGGAGGCCCGGCTGG + Exonic
1132680808 16:1141018-1141040 CCAGTCTGGGGATGCCAGGAAGG - Intergenic
1132713726 16:1280297-1280319 CCTGTATGGGGAGGACAGTCAGG + Intergenic
1138475248 16:57266790-57266812 CCTGTCTGGGGAGGCATGGCAGG - Intronic
1138672737 16:58629128-58629150 CCCGGATGGGAAGGGCGGGCGGG - Intronic
1140257954 16:73352886-73352908 CCAGTTTAGGGAGGCCAGGCTGG - Intergenic
1141800443 16:86304262-86304284 CGAGGATGGGGTGGCCGGTCAGG - Intergenic
1143026073 17:3942631-3942653 CCAGTAGGGTGAGGGCGGGTGGG + Exonic
1143780295 17:9225650-9225672 CCAGTAGGGGGAGGGCAGGAGGG + Intronic
1144220965 17:13099473-13099495 CCAGTCCGGGGAGGCTGGCCTGG + Intergenic
1144236174 17:13262560-13262582 CAGGGATGGGGAGGCCAGGCAGG + Intergenic
1144578370 17:16443917-16443939 CCAGTGTGGTGAGGCGGGGCAGG + Exonic
1144599028 17:16597053-16597075 CCAGTAAGGGGAGGCTGGGGTGG - Intergenic
1144638562 17:16925622-16925644 ACAGCTAGGGGAGGCCGGGCAGG + Intergenic
1146193088 17:30787701-30787723 GAAGTATGGGGAGGAGGGGCCGG + Intronic
1146943753 17:36860601-36860623 CCAGTGAGGGGAGCCCGGGCAGG + Intergenic
1147118735 17:38322402-38322424 CCAGGAAGGGAAGGCCGGGTGGG + Intronic
1147565127 17:41531272-41531294 CCAGTTGGGGAAGGCTGGGCAGG - Intergenic
1147852460 17:43452586-43452608 CCCGGATGGGGAGGCTGGCCAGG - Intergenic
1149633077 17:58142724-58142746 CCAGGATGGGGCGGCCGGCCAGG - Intergenic
1150130695 17:62667141-62667163 CCTGGACGGGGAGGCCGGGGCGG + Intronic
1151733219 17:75923141-75923163 CTAGTAGGGGGAGGACTGGCTGG - Intronic
1152106802 17:78334952-78334974 CCAGGATGGGGAGGGCGAGCTGG - Intergenic
1152468912 17:80480185-80480207 CCAGTATGGAGAGGGTGGCCAGG + Intergenic
1152597917 17:81246871-81246893 CCAGGCAGGGTAGGCCGGGCTGG - Exonic
1153192711 18:2559983-2560005 GCACTATGGGGAGGCCGAGGTGG - Intronic
1157149815 18:45205326-45205348 CCAGTGTGGGAAGGATGGGCTGG + Intergenic
1160150069 18:76391890-76391912 CCAGCAGGAGGAGGCCGGGCAGG + Intronic
1160184018 18:76660702-76660724 CCAGAATGGGGAGGAGGAGCAGG + Intergenic
1161401233 19:4066959-4066981 CCAGGCTGGGGGGGGCGGGCTGG - Intergenic
1161448250 19:4329777-4329799 CCATGCTGGGGAGGCAGGGCAGG - Intronic
1161556828 19:4947746-4947768 CCAATATTGGGAGGCCGAGGAGG - Intronic
1162016156 19:7847645-7847667 CCAGGAGGGGGAGGATGGGCTGG + Intronic
1163447027 19:17352905-17352927 CCCTGATGGGGAGGCCTGGCAGG - Intronic
1163722886 19:18906601-18906623 CCGGTATGGGGGGCCCGGGGAGG + Intronic
1163796555 19:19341386-19341408 CCACTATCTGGATGCCGGGCAGG + Exonic
1164898731 19:31899896-31899918 CCAGTATGAGGAGGACTGGATGG - Intergenic
1165080507 19:33303503-33303525 CCTGAATGGGGAGGCGGGGGAGG - Intergenic
1165172847 19:33906087-33906109 CCGGTTCCGGGAGGCCGGGCGGG + Intergenic
925405843 2:3605219-3605241 CCAGTGTCGGGTGGCAGGGCCGG + Intronic
925876530 2:8316012-8316034 CCAGCATGGGAAGGCTGGGCTGG + Intergenic
928135876 2:28687073-28687095 CCGGTTTGGGGAGGCCAGGTTGG + Intergenic
929739863 2:44589025-44589047 CCCGGATGGGGCGGCCGGCCGGG - Intronic
930076119 2:47407100-47407122 ACAGCATGGGGACCCCGGGCTGG - Intronic
930762258 2:55049861-55049883 GGAGGAGGGGGAGGCCGGGCCGG + Exonic
931560198 2:63553323-63553345 CCAGGATCGGGAGGATGGGCGGG - Intronic
932446543 2:71785308-71785330 GCAGGGTGGGGAGGACGGGCAGG + Intergenic
933812890 2:86044201-86044223 CCTGTATGGGGAGGATGGCCTGG - Exonic
934985217 2:98880502-98880524 TCAGTATGGGCACGGCGGGCAGG + Intronic
935261057 2:101356257-101356279 CCAGGATGTGGGGGCAGGGCAGG + Intronic
936462580 2:112723715-112723737 GCAGGATGGGGAGGCGTGGCTGG - Exonic
937001575 2:118472471-118472493 CCAGCATTGGGAGGCCGAGGCGG - Intergenic
937042772 2:118834667-118834689 CCAGAAGGGTGAGGCCGGGCAGG - Intergenic
941197621 2:162470591-162470613 CCCGGATGGGGCGGCCGGCCTGG - Intronic
941862026 2:170292706-170292728 CCAGTGTGGGAAGGCTGGGTAGG + Intronic
942249276 2:174033853-174033875 CCAGGATGGAGAGGACAGGCAGG + Intergenic
944297058 2:198077541-198077563 CCAGTATTTAGAGGCTGGGCAGG - Intronic
947832068 2:233148531-233148553 CCAGGTTAGGGAGGCCAGGCAGG + Intronic
947963288 2:234258020-234258042 CAAGGATGGGAAGGCCGGGAGGG + Intergenic
948309518 2:236974563-236974585 CCCATGTGGGGTGGCCGGGCTGG + Intergenic
948694627 2:239727000-239727022 GCAGGATGGGGAGGCCAGGCCGG - Intergenic
948751524 2:240136118-240136140 CCGGGGAGGGGAGGCCGGGCGGG - Intronic
949050421 2:241894858-241894880 CCACTGTGGCCAGGCCGGGCAGG - Intronic
1171488900 20:25502986-25503008 CCACAATGGGGAGGACGGGAGGG + Intronic
1172280039 20:33701712-33701734 CCCGGATGGGGTGGCCGGCCGGG - Intergenic
1172910801 20:38407644-38407666 CCAGGATGGGGCGGCTGGCCGGG - Intergenic
1174423416 20:50415652-50415674 CCAGGCTGGGTAGGCCAGGCCGG + Intergenic
1175772477 20:61632530-61632552 CCGGGAGGGGGAAGCCGGGCTGG - Intronic
1179052336 21:37898335-37898357 CCAGTATTGGGAGGCCAAGGTGG + Intronic
1179450692 21:41466564-41466586 CCAGGAGGAGGAGGCAGGGCAGG - Intronic
1179720641 21:43314268-43314290 CCAGAGTGGGGAGGCCCTGCTGG + Intergenic
1179803377 21:43822426-43822448 CCCGTATGGGGCGGCTGGCCGGG - Intergenic
1180999697 22:19982306-19982328 CCAGGATGGGGTGCCGGGGCAGG - Intronic
1181106631 22:20579522-20579544 CCAGTATGTGGGGGCGGGGGTGG + Intronic
1183302340 22:37064479-37064501 CCAGGATGGAGAGGATGGGCCGG - Intergenic
1183427836 22:37748982-37749004 TCAGCAAGGGGAGGCCAGGCTGG + Intronic
1183731564 22:39621478-39621500 TCAGTCTGGGCAGGCCTGGCGGG + Intronic
1183841048 22:40501120-40501142 CCCGGACGGGGAGGCCGGCCGGG + Intronic
1183945616 22:41324209-41324231 GCAGTATGGGGAGGGAGGGCAGG + Intronic
1184597270 22:45521713-45521735 CCAGGTTGGGGAGGCTGGGGCGG - Intronic
1185348986 22:50324382-50324404 CCAGTATTGTGGGGCTGGGCTGG + Intronic
950669081 3:14514444-14514466 CCAGCACGGTGGGGCCGGGCGGG - Exonic
950683906 3:14603003-14603025 CCGGGCTGGCGAGGCCGGGCCGG - Intergenic
950742469 3:15062154-15062176 CCAGTACGGGGCGGCTGGCCGGG - Intronic
952316883 3:32239089-32239111 CCACGATGAGGAAGCCGGGCAGG - Exonic
953980733 3:47411716-47411738 GCAGTGTGGGGTGGCAGGGCAGG + Intronic
954162885 3:48734656-48734678 CCAGGATGGGGCGGCTGGCCGGG - Intronic
954383869 3:50234304-50234326 CCAGTACTGGGAGGCCGAGGCGG - Intronic
954676793 3:52320357-52320379 CCCGCTAGGGGAGGCCGGGCAGG + Intronic
954710160 3:52501565-52501587 CCAATGTGGGGAGGCTGGGTGGG + Intronic
961351697 3:126308312-126308334 CCAAGATGGGGAGGCAGGGCCGG + Intergenic
961522311 3:127473786-127473808 CCAGGATGAGAAGGCAGGGCTGG + Intergenic
961603230 3:128076390-128076412 CCGGCATGGAGAGGCGGGGCCGG + Intronic
961614778 3:128170135-128170157 CCAGGCGGGGGAGGCGGGGCGGG - Intronic
963947659 3:151163994-151164016 CCGGCATGGGGAGGCTGGACGGG - Exonic
967896547 3:194400491-194400513 CCCGGATGGGGCGGCCGGCCGGG - Intergenic
968631832 4:1655885-1655907 CCAGCAAGGGCAGGCGGGGCTGG - Intronic
969021708 4:4143566-4143588 CGAGTATGGGGACGCCGCGGAGG - Intergenic
970417837 4:15876490-15876512 CCAGTATGGTGAGGTCAGGTGGG - Intergenic
976222800 4:82771597-82771619 ACAGTTTGGGGAGGCTGGGGAGG + Intronic
976765482 4:88593169-88593191 CCACTTCGCGGAGGCCGGGCCGG + Intronic
977752668 4:100627963-100627985 CTTTTATGGGGAGGCGGGGCAGG - Intronic
982022206 4:151214733-151214755 CCCGGATGGGGAGGCTGGCCGGG + Intronic
982276329 4:153640074-153640096 CCAGTGTTGAGAGGCGGGGCAGG + Intergenic
982846458 4:160259182-160259204 CCAGCATTGGGAGGCCGAGGTGG - Intergenic
984728084 4:183040718-183040740 CCAGAATGGGGTGGCTGGCCGGG + Intergenic
984864717 4:184271857-184271879 CCAGCATGGGAAAGCCAGGCTGG - Intergenic
985532729 5:443385-443407 CGCGTAGGGGGAGGCCGGACCGG + Intronic
986366786 5:7040804-7040826 CCAGTATGGGGAGGTGGGAAGGG + Intergenic
986367291 5:7045153-7045175 GCACTTTGGGGAGGCCGAGCGGG - Intergenic
986429651 5:7669007-7669029 CCAGTATGAGGAGGCACAGCAGG + Intronic
989272164 5:39546232-39546254 CCAGTACTGGGAGGCCGAGATGG + Intergenic
998038302 5:138935127-138935149 CCAGGATGGGGATGCCCGGGAGG + Intergenic
999438676 5:151584269-151584291 TCTGTGTGGGCAGGCCGGGCAGG - Intergenic
999748850 5:154611355-154611377 CCAGCGTGGGGAGGCGGGGATGG - Intergenic
1001369755 5:171186781-171186803 CCAGTGTTGGGAGGCCGAGGCGG - Intronic
1001427163 5:171630286-171630308 CCAGGATGGCGAGGCTGCGCGGG - Intergenic
1002273232 5:178086529-178086551 CCAGGATGGGGTGGACGGGGCGG + Intergenic
1002772881 6:304327-304349 CCAGGGTGGGCAGGCGGGGCAGG + Intronic
1003925256 6:10871553-10871575 GCAGGATGGGGAGGAAGGGCCGG - Intronic
1003961342 6:11211899-11211921 CCAGGATGGGGAGGGCAGGAGGG + Intronic
1005621930 6:27628348-27628370 CCAGTTTTGGGATGCCGGGTGGG - Intergenic
1006964988 6:37974309-37974331 GCAGTCTGGGGAGGCCGAGGAGG - Intronic
1007095668 6:39211198-39211220 GCAGAGTGGGGAGGCTGGGCTGG + Intronic
1008846190 6:55966856-55966878 GCACTTTGGGGAGGCCGGGGCGG - Intergenic
1010629886 6:78186682-78186704 CTAGTATGGGGAGGCAGGGAGGG - Intergenic
1010795895 6:80115881-80115903 CCAGCATTGGGAGGCCGAGGGGG - Intronic
1014114253 6:117654626-117654648 CCAGGATTGGGATGCAGGGCTGG + Intergenic
1015634271 6:135260693-135260715 CCAGTATGGCTTGGCAGGGCAGG - Intergenic
1018908076 6:168086721-168086743 GCAGTATGGGGATGCCGAGGGGG - Intergenic
1019345220 7:526433-526455 CCTGCAGGGGGAGGCCTGGCTGG + Intergenic
1019404819 7:877700-877722 CAGGGAGGGGGAGGCCGGGCAGG - Intronic
1019469635 7:1211840-1211862 CCTGCATGGGGCTGCCGGGCTGG - Intergenic
1019629580 7:2041182-2041204 CTAGGAAGGGGAGGCAGGGCAGG - Intronic
1020242096 7:6403329-6403351 CCAATTTGGGGAGGCATGGCAGG - Intronic
1023243737 7:38178384-38178406 CCAGCCTGGGGCGGCCGGCCAGG + Exonic
1024231831 7:47368812-47368834 CCCAGATGGGGAGGCCCGGCTGG - Exonic
1024247922 7:47484485-47484507 ACAGGATGAGGCGGCCGGGCTGG + Intronic
1025803608 7:64809513-64809535 CCAGGATGGGGCGGCTGGCCGGG + Intronic
1032194482 7:129781171-129781193 GCCGTCTGGGGCGGCCGGGCGGG - Intergenic
1034170772 7:149061366-149061388 CCAGAATTGGGAGGCTGAGCCGG + Intergenic
1035158594 7:156934573-156934595 CCAGGCTGGGGAGGCTGTGCTGG + Intergenic
1036700270 8:11008703-11008725 AAAGTCTGGGGAGGCCGGGGTGG - Intronic
1037860163 8:22399234-22399256 CTGGGACGGGGAGGCCGGGCAGG - Intronic
1039858751 8:41438431-41438453 GCAGTGAGGGGAGGTCGGGCTGG + Intergenic
1039873604 8:41567376-41567398 GCAGCAGGAGGAGGCCGGGCCGG - Intergenic
1041131988 8:54710820-54710842 ACAGGATGGGGAGGTGGGGCAGG + Intergenic
1041920732 8:63179866-63179888 CCCGGATGGGGCGGCCGGCCAGG + Intronic
1049195839 8:141315228-141315250 TCAGGATGGGGAGGAGGGGCAGG + Intergenic
1056349717 9:85737861-85737883 ACAGGGTGGGGAGGCCGGGGAGG - Intronic
1057413894 9:94844636-94844658 CCAGCATGGGGAGGAAGGACAGG - Intronic
1057718377 9:97513651-97513673 CCACTATGGGGAGGGCATGCTGG - Intronic
1059398467 9:114053752-114053774 CCATTAGAGGGAGGCCTGGCTGG - Exonic
1060176613 9:121501918-121501940 CCAGTAGGTGGAGGTCAGGCTGG - Intergenic
1060527903 9:124330797-124330819 CCACTGTGGGCAGGCAGGGCAGG + Intronic
1060682508 9:125577699-125577721 CCCGGATGGGGCGGCCGGCCGGG - Intronic
1061047731 9:128176221-128176243 ACAGTGTGAGGAGGCCTGGCTGG + Intronic
1061405029 9:130388953-130388975 CCAGAATGGGGAGGCCTGGATGG - Intronic
1061755473 9:132809312-132809334 CCAGTTTCAGGAGGCAGGGCAGG + Intronic
1061821322 9:133228473-133228495 CCCGGATGGGAAGGCTGGGCTGG - Intergenic
1062010028 9:134261901-134261923 CCTGAAAGGGGAGGCCGGGTTGG + Intergenic
1062041236 9:134405211-134405233 CCAGGATGGGGAGGCCAGGCGGG - Intronic
1062227586 9:135462064-135462086 CCAGTGAGGCGAGGCAGGGCTGG - Intergenic
1062237924 9:135521594-135521616 CCCGGATGGGAAGGCTGGGCTGG + Intronic
1062442278 9:136576189-136576211 CCAGGCTGGGCAGGCTGGGCAGG - Intergenic
1062494483 9:136825371-136825393 CCAGTATGCTGAGGCCAGGAGGG + Intronic
1188367572 X:29333552-29333574 CCAGGATGGGGCGGCTGGCCAGG + Intronic
1188428839 X:30082241-30082263 TCAGAATGGGGAGGCTGGGAGGG - Intergenic
1189180961 X:39004132-39004154 CCAGGCTGTGGAGGCTGGGCTGG + Intergenic
1190906857 X:54736676-54736698 CCCGGATGGGGAGGCTGGCCGGG - Intergenic
1191010017 X:55748979-55749001 CCCGGATGGGGCGGCCGGCCGGG - Intronic
1192821614 X:74652444-74652466 CCAGTCGGGGGAGGAGGGGCAGG - Intergenic
1197750310 X:129959453-129959475 CGTGTAGGGGGAGGCAGGGCTGG + Intergenic
1199601750 X:149545246-149545268 CCAGAGTGGAGAGTCCGGGCTGG - Intronic