ID: 1068783141

View in Genome Browser
Species Human (GRCh38)
Location 10:60943594-60943616
Sequence GCCAGTATGGGGAGGCCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 261}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068783141_1068783153 10 Left 1068783141 10:60943594-60943616 CCGCCCGGCCTCCCCATACTGGC 0: 1
1: 0
2: 1
3: 20
4: 261
Right 1068783153 10:60943627-60943649 GAAGCGCCTTCTCGTCGGCGCGG No data
1068783141_1068783155 27 Left 1068783141 10:60943594-60943616 CCGCCCGGCCTCCCCATACTGGC 0: 1
1: 0
2: 1
3: 20
4: 261
Right 1068783155 10:60943644-60943666 GCGCGGCACCACCCCCTCCCTGG No data
1068783141_1068783152 5 Left 1068783141 10:60943594-60943616 CCGCCCGGCCTCCCCATACTGGC 0: 1
1: 0
2: 1
3: 20
4: 261
Right 1068783152 10:60943622-60943644 AAGGGGAAGCGCCTTCTCGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068783141 Original CRISPR GCCAGTATGGGGAGGCCGGG CGG (reversed) Intronic
900091877 1:924250-924272 GGCAGTCCGGGGAGGCCTGGCGG + Intergenic
900480246 1:2894718-2894740 GTCAGGGTGGGGAGGCAGGGTGG - Intergenic
900516666 1:3085433-3085455 GCCAGAATGGGGAGCCCTGGGGG - Intronic
900600983 1:3502534-3502556 GCTAGAATGGGGAGGGCAGGGGG + Intronic
901344800 1:8530491-8530513 GCCAAAATGGGGAGGCGGGGCGG + Intronic
903471455 1:23590540-23590562 GCCAGGATGGAGAAGCAGGGAGG + Intronic
903501191 1:23800855-23800877 GCCACTACGGGGAGGGCGGGAGG + Intergenic
904340442 1:29830626-29830648 GCCATGGTGGGGAGGCTGGGAGG + Intergenic
905219341 1:36433483-36433505 GCAAGAATGGGGAGGGAGGGAGG + Intronic
905389007 1:37624354-37624376 GCCTGGCTGAGGAGGCCGGGTGG + Intronic
905397158 1:37674166-37674188 GCCAGTGTGGCAATGCCGGGTGG + Intergenic
907048854 1:51316341-51316363 GCCAGTATGGGCAGGTCAGGAGG - Intronic
909539163 1:76771559-76771581 GCCAGTGTGGGGTGGCTGGTAGG - Intergenic
912391565 1:109306807-109306829 GGGAGGGTGGGGAGGCCGGGTGG - Intronic
915269633 1:154744525-154744547 GCCAGTAGGTGATGGCCGGGAGG + Intronic
919740024 1:200975684-200975706 GCCAGTAGGGAGAGGCCAAGTGG + Intronic
923158819 1:231300378-231300400 GCCAGTAGGGTAAGGCCAGGTGG - Intergenic
923159065 1:231301916-231301938 GCCAGTAGGGTAAGGCCAGGTGG - Intergenic
1063151460 10:3340311-3340333 GACGGTGTGGGGAGGCGGGGAGG + Intergenic
1063696094 10:8336548-8336570 GCCTGTTTGGGGAGGCCGAGAGG + Intergenic
1063918416 10:10908073-10908095 GACTGTACGGGCAGGCCGGGCGG - Intergenic
1064086860 10:12351554-12351576 GCCAGTGTGGGGGGCTCGGGTGG - Intronic
1067024874 10:42836233-42836255 GCGAGGAGGTGGAGGCCGGGAGG - Intergenic
1067848599 10:49741032-49741054 GGCAGGCTGGGGAGGCCTGGTGG - Intronic
1068783141 10:60943594-60943616 GCCAGTATGGGGAGGCCGGGCGG - Intronic
1068903739 10:62299417-62299439 GCCAGTATCTGGAGGCTGGAAGG + Intergenic
1069960140 10:72074709-72074731 GGAAGGATGGGGAGGGCGGGAGG + Intronic
1070740263 10:78898712-78898734 GCCAGCATGGGGGAGCAGGGTGG - Intergenic
1073441542 10:103555458-103555480 GACCGCCTGGGGAGGCCGGGCGG + Intronic
1074824737 10:117206613-117206635 GGGAGCAAGGGGAGGCCGGGAGG - Intronic
1075060646 10:119254555-119254577 GCCAGTATGGGGAGGGAGAAGGG + Intronic
1075625635 10:123962788-123962810 GCAAGTACGGGGAGGCTGGATGG - Intergenic
1076724401 10:132406812-132406834 GCCAGTCTGGGGAGTTGGGGTGG - Intronic
1077352116 11:2097837-2097859 GCCAGAGTGGGGAGGGCCGGGGG - Intergenic
1079382446 11:19949739-19949761 GCAAGTAGGAGGGGGCCGGGAGG - Intronic
1080185061 11:29472852-29472874 GCCAGTAGCTGGAGGGCGGGGGG + Intergenic
1082278531 11:50246519-50246541 GCCAGTCTGGGAGGGCTGGGGGG - Intergenic
1083894667 11:65613958-65613980 GGCAGTGTGGTCAGGCCGGGGGG + Exonic
1084181431 11:67448485-67448507 GCCATGGTGGGGAGGCCTGGGGG + Intergenic
1084540257 11:69782113-69782135 GCCAGTGTGTGGAAGCTGGGTGG + Intergenic
1088481047 11:110296658-110296680 GCCGGCAGGGGGAGGCGGGGGGG - Exonic
1089625474 11:119748327-119748349 CCCAGGATGGGAAGGCAGGGCGG - Intergenic
1089753191 11:120666425-120666447 GCCAGTGTGGCGACGCCTGGGGG + Intronic
1090423682 11:126592689-126592711 GCCAGGGTGGGGAGCCCAGGAGG + Intronic
1091300307 11:134503187-134503209 GCCAGGAGGGGGAGGCGGAGAGG + Intergenic
1094218330 12:27969346-27969368 GCCGGGTTGGGGAGGCCAGGGGG - Intronic
1096796225 12:54079584-54079606 GCCAGGCTGCGGAGGCCGAGCGG + Intergenic
1099808977 12:87556648-87556670 GTCAGTATGGGGAAGGTGGGAGG + Intergenic
1101978468 12:109383832-109383854 CCCAGTATGTGGAGTCGGGGTGG - Intronic
1102455032 12:113065788-113065810 GCCAGGACGGGGAGGCCACGGGG + Intronic
1104748785 12:131225455-131225477 GCCTGTCTGTGGGGGCCGGGAGG - Intergenic
1104784338 12:131440109-131440131 GCCTGTCTGTGGGGGCCGGGAGG + Intergenic
1104928217 12:132324745-132324767 ACCAGAATGGAGAGGCTGGGGGG - Intronic
1113254937 13:108496030-108496052 GCCGGGCTGGGGACGCCGGGAGG + Intergenic
1113521140 13:110941942-110941964 GCCAGTATGGGAAGGAGGTGGGG + Intergenic
1113785909 13:113002034-113002056 GACAGTGCGGGGACGCCGGGCGG + Intronic
1113901656 13:113801323-113801345 GCCAGGATGGGAAGGCCGTCGGG - Intronic
1113940370 13:114015759-114015781 GACAGCCTGGGGAGGCAGGGAGG + Intronic
1115664642 14:35534091-35534113 GCCAGCCCGGGGAGGCCCGGCGG + Exonic
1115695863 14:35898082-35898104 GGCAGTATGTGGAGGTAGGGAGG + Intronic
1117150645 14:52884312-52884334 GCCAGTCTGGGCAGGCGCGGTGG + Intronic
1119435085 14:74593258-74593280 GCCTGCATGGGGTGGTCGGGAGG - Intronic
1122540535 14:102495550-102495572 GGCTGGGTGGGGAGGCCGGGCGG + Intronic
1122826822 14:104374610-104374632 GTGGGTATGGGGAGGCCGGAGGG + Intergenic
1123106536 14:105844428-105844450 GCCAGGCTGGGGCGGGCGGGAGG + Intergenic
1123139283 14:106059814-106059836 GCCTGTATGTGGAGGGAGGGAGG - Intergenic
1123425508 15:20167690-20167712 GCGAGGAGGTGGAGGCCGGGAGG - Intergenic
1123534730 15:21174208-21174230 GCGAGGAGGTGGAGGCCGGGAGG - Intergenic
1124363515 15:29055258-29055280 GCCAGTGTTGGGTGGCCTGGTGG + Intronic
1124962863 15:34411018-34411040 GCCAGTGTTGGGTGGCCTGGTGG + Intronic
1124979486 15:34557240-34557262 GCCAGTGTTGGGTGGCCTGGTGG + Intronic
1129177736 15:73852288-73852310 GCCAGAATGTGAAGGCCTGGAGG + Intergenic
1129516462 15:76160495-76160517 GCCAGTAAGGAGCGGGCGGGAGG + Intronic
1129829028 15:78655322-78655344 GCTAGGATAGGGAGGCTGGGAGG - Intronic
1131150459 15:90044332-90044354 GCCAGAGTGGGGAGGCCCGTGGG - Intronic
1131165809 15:90141596-90141618 GCCAGTTTGGGGTGGATGGGAGG + Intergenic
1132539750 16:503215-503237 GACAGTCTGGGGAGCCCTGGAGG - Intronic
1133278049 16:4649828-4649850 GGCAGTGTGGAGAGGCCAGGAGG + Intronic
1134625647 16:15720798-15720820 GCCAGCAGAGGGAGGTCGGGTGG - Intronic
1138558700 16:57787528-57787550 CCCAGAAAGGGGAGGACGGGAGG + Intronic
1139708784 16:68760823-68760845 CCCAGAGTGGGGAGGCCAGGGGG + Intronic
1142637048 17:1264255-1264277 GGCGGTGTGGGGAGGGCGGGTGG - Intergenic
1142721463 17:1778839-1778861 GCCAGTTTGGAGAGGTCTGGTGG + Intergenic
1143026071 17:3942630-3942652 GCCAGTAGGGTGAGGGCGGGTGG + Exonic
1143658721 17:8312137-8312159 GCCATTGTGGGGAGGCCCTGGGG - Exonic
1143668419 17:8378829-8378851 GCAAGTGTGAGGAGGCCGAGGGG + Intronic
1143780293 17:9225649-9225671 ACCAGTAGGGGGAGGGCAGGAGG + Intronic
1144100411 17:11937690-11937712 GCCAGCATGGTGATGACGGGAGG - Intronic
1145034871 17:19533963-19533985 GCCAGTGCGCGGAGGCCCGGAGG + Exonic
1145902618 17:28498296-28498318 GGGAGTGTGGGGAGGCCGGGTGG - Intronic
1145935364 17:28711811-28711833 GCCGGGCTGGGGAGGCCGGCGGG - Exonic
1145994047 17:29095560-29095582 CCCAGTATGGGGTGTCCGGGTGG - Intronic
1146730946 17:35193640-35193662 GCCACTGTTGGGAGGCAGGGGGG + Exonic
1147118733 17:38322401-38322423 CCCAGGAAGGGAAGGCCGGGTGG + Intronic
1147159994 17:38564079-38564101 GCCTGTGTGGGGAGGGAGGGTGG + Intronic
1147425850 17:40345534-40345556 GCCAGGATGGGGAGCGAGGGAGG + Intronic
1147578011 17:41613637-41613659 GGCAGGATGGGGAGGCTGAGGGG - Intronic
1148540001 17:48472789-48472811 GCCAGAGTGGGGAGGAGGGGTGG - Intergenic
1149589551 17:57818400-57818422 GCCAGTCGGTGGAGGCAGGGAGG + Intergenic
1151192928 17:72411869-72411891 GTCAGTATGGGGAGGCAAGGGGG + Intergenic
1151764405 17:76124749-76124771 GCCAGGATGGCGATGCAGGGAGG + Intergenic
1151917642 17:77130212-77130234 GCCAGTGTGGGGTGGAGGGGTGG + Intronic
1152066552 17:78115531-78115553 GCCAGGCTGGGTAGCCCGGGGGG + Intronic
1152420596 17:80190918-80190940 GCAAGCATGGGGTGGCGGGGTGG - Intronic
1152694838 17:81738896-81738918 GGCAGGACGGGGAGGACGGGTGG - Intergenic
1152717828 17:81908390-81908412 GCCATTGTGGGGTGGCCTGGAGG - Intronic
1153828702 18:8900712-8900734 GACAGTATGGGTAGACAGGGAGG + Intergenic
1155393667 18:25363923-25363945 ACCAGCATGGGGAGGCATGGTGG - Intergenic
1156457325 18:37302167-37302189 GCCAGGAAGGGGTGGCCGGTGGG - Intronic
1156474135 18:37394957-37394979 GACAGTGAGTGGAGGCCGGGTGG - Intronic
1157281785 18:46351091-46351113 GCCAGTCTGCAGAGCCCGGGAGG + Intronic
1159926971 18:74278166-74278188 GCCAGTTAGGGGAGGCCCTGGGG + Intronic
1160208461 18:76857130-76857152 GGAATTATGGGGAGGCGGGGAGG - Intronic
1160412926 18:78687439-78687461 GCCTGAATGGGGAGCCCGAGGGG - Intergenic
1161265590 19:3362184-3362206 GCCTGTATGGGAATACCGGGGGG + Intronic
1161283363 19:3457158-3457180 GCCAGTGTGAGGAGTCAGGGCGG + Intronic
1161571187 19:5031654-5031676 GGCAGTAGGTGGAGGCCAGGGGG + Intronic
1162109525 19:8392482-8392504 GCCAGTGTGGGGAGGGCAGCAGG - Intronic
1162823333 19:13236460-13236482 GCGGGAATGGGGAGGACGGGAGG + Intronic
1163149090 19:15400658-15400680 ACCAGCATGGGGAGGCAGTGTGG - Intronic
1163535048 19:17872220-17872242 GGCAGGACGGGGAGGGCGGGTGG - Exonic
1163583046 19:18149491-18149513 GGCTGGATGGGGAGGCGGGGCGG + Exonic
1164145664 19:22511054-22511076 GTGAGTATGGGGAGGCAGTGAGG - Intronic
1165015939 19:32879984-32880006 GCCGGGATGGGGAGGCCCTGAGG + Intronic
1165172845 19:33906086-33906108 GCCGGTTCCGGGAGGCCGGGCGG + Intergenic
1166256967 19:41613555-41613577 GGCAGTATGGGGAGGACAGAGGG + Intronic
1166330523 19:42075793-42075815 GCCATTTTGGGGACGCCGTGAGG - Intronic
1167510373 19:49892683-49892705 GCCAGAAGGGGGAAGCCAGGTGG - Intronic
1168317063 19:55489069-55489091 GGCAGAAGGGGGAGGCCTGGGGG - Intronic
925284242 2:2705532-2705554 GCCAGTGTGGGGAGCCCAGATGG + Intergenic
925302352 2:2826343-2826365 GCCGGTGAGGGGAGGCCTGGGGG - Intergenic
926142672 2:10377628-10377650 GCCAGTGTGGGGAGGTGGGCAGG - Intronic
927879831 2:26682525-26682547 GTCACCATGGGGAGGCCTGGGGG - Intergenic
928904830 2:36357009-36357031 GCCAGTGCGGGGAGGGCGGTAGG - Intronic
935635155 2:105244158-105244180 GCCAGTGTGGGGACCCCTGGTGG - Intergenic
935822162 2:106905437-106905459 GGCGGTATGGGGGGGTCGGGGGG - Intergenic
946335161 2:219031072-219031094 GCCAGTCTGGGGACGGTGGGAGG + Intronic
946421482 2:219567539-219567561 GCCAATATGGGGGGTCCTGGGGG + Exonic
946946199 2:224825263-224825285 GCCAGTCTGGCCAGGCGGGGTGG - Intronic
947963287 2:234258019-234258041 CCAAGGATGGGAAGGCCGGGAGG + Intergenic
948147284 2:235717051-235717073 GGCAGTGTGGGGAGACCTGGGGG - Intronic
948927770 2:241110515-241110537 GCCAGAAAGGAGAGGCCAGGAGG + Intronic
1169622572 20:7524663-7524685 GCCAGCATGGGGATGGGGGGTGG - Intergenic
1171222142 20:23408213-23408235 CCCAGTGTGGGGAGCCTGGGGGG + Intronic
1171488898 20:25502985-25503007 TCCACAATGGGGAGGACGGGAGG + Intronic
1172448372 20:35004819-35004841 GCCAGTCTGGGGAGGGCTGAGGG - Intronic
1174052772 20:47778824-47778846 GGCACTAGGGGGAGGCTGGGGGG + Intronic
1174368062 20:50068317-50068339 GGCACGATGGGGAGGCCAGGTGG + Intergenic
1175171781 20:57086037-57086059 GCCAGTCTGGGGTGGCGGAGTGG - Intergenic
1175658883 20:60795139-60795161 GGCAGGATCGGGTGGCCGGGTGG + Intergenic
1176248495 20:64109017-64109039 GCCAGTTTGGGGATGGCGGTGGG + Intergenic
1178355212 21:31905647-31905669 GCCAGTGCAGGGAGGCCAGGAGG + Intronic
1179626054 21:42650212-42650234 GCCAGGCTGGGGACCCCGGGTGG - Intergenic
1179983614 21:44909190-44909212 AGCGGGATGGGGAGGCCGGGGGG + Intronic
1181462529 22:23094166-23094188 GGCAGGATGGGGAGGCTGCGTGG + Intronic
1182300311 22:29333394-29333416 GCCACAATGGGGAGGCTGGTAGG + Intronic
1183731563 22:39621477-39621499 GTCAGTCTGGGCAGGCCTGGCGG + Intronic
1184109306 22:42385587-42385609 GCCAGGGTGGGGAGGGAGGGAGG - Intronic
1184551264 22:45205386-45205408 GCCAGTATAGGGAGGCCACCCGG + Intronic
950066469 3:10115828-10115850 GCCAGCAAGGGGAGGCGGGGAGG + Intronic
953922147 3:46959691-46959713 GCCAGTGTGGGGGGACAGGGAGG + Intronic
954300781 3:49699719-49699741 GCCAGTGTGAGGAGGACGGTGGG - Exonic
954710158 3:52501564-52501586 GCCAATGTGGGGAGGCTGGGTGG + Intronic
955381431 3:58441418-58441440 GCCAGTTTGGAAAGGCTGGGTGG + Intergenic
956080172 3:65549175-65549197 GCCAGCCTGGGGAGGCGGGAAGG + Intronic
957073222 3:75581447-75581469 GGGAGACTGGGGAGGCCGGGAGG + Intergenic
958718806 3:97820953-97820975 GGCAGCGTGGGGAGGCAGGGAGG + Intergenic
960714278 3:120560066-120560088 GCCAGAATGGGGGGGGGGGGGGG - Intergenic
961436809 3:126924792-126924814 GCCAGAATGGGTGGGCCTGGAGG + Intronic
961512057 3:127409242-127409264 GGCAGGGAGGGGAGGCCGGGAGG - Intergenic
961614780 3:128170136-128170158 GCCAGGCGGGGGAGGCGGGGCGG - Intronic
963266657 3:143246387-143246409 GCAAGAATGGGGGGGCGGGGTGG + Intergenic
964483036 3:157160732-157160754 GCCAGTATGGGGAAGTAGGGCGG + Intronic
964753606 3:160074806-160074828 GGCAGTAGTGGGAGGCAGGGTGG + Intergenic
964754840 3:160083664-160083686 GCCAGTAGGGTTAGGCCAGGTGG - Intergenic
965757388 3:172040186-172040208 CCCAGGAGGGGGAGGGCGGGCGG + Intronic
965849856 3:173010403-173010425 GCCAGAGTGGTCAGGCCGGGTGG - Intronic
966329252 3:178792942-178792964 GCCAAGATGGGAAGGCTGGGTGG - Intronic
967269844 3:187724575-187724597 CCCAGTATGGGGTGTCCAGGAGG + Intronic
967867071 3:194198920-194198942 GCCAGCACAGGGAGGCCAGGGGG - Intergenic
967958754 3:194901329-194901351 GACAGTGTGGGCAGGCAGGGTGG - Intergenic
967976127 3:195035680-195035702 GGCAGAATGAGGAGGCCGGCAGG - Intergenic
968540272 4:1164781-1164803 GTCAGCATGGGGAGCCAGGGGGG - Intergenic
968545006 4:1193998-1194020 GCCAGTATGTGGAACCCAGGGGG + Intronic
968699131 4:2046605-2046627 TCCAGTGTGGGGTGGCAGGGAGG - Intergenic
968914672 4:3492241-3492263 GCCAGCATGGTGAGGGCAGGGGG + Intronic
970417771 4:15876059-15876081 GCCAGTATGCTGAGGTCAGGTGG + Intergenic
970417839 4:15876491-15876513 GCCAGTATGGTGAGGTCAGGTGG - Intergenic
980943935 4:139301364-139301386 GCCTGCCTGTGGAGGCCGGGAGG - Intronic
985340439 4:188946755-188946777 GCCAGTTGGGGGAGGGCGGTGGG + Intergenic
985618724 5:940758-940780 GCCTGTCTGGGGAGGGTGGGTGG - Intergenic
985675755 5:1230508-1230530 GCCAGCATGTGGGGGCCGGACGG - Intronic
986366784 5:7040803-7040825 CCCAGTATGGGGAGGTGGGAAGG + Intergenic
987443903 5:17992479-17992501 GCCAGTATGGAAAGCCCTGGAGG - Intergenic
989436435 5:41418694-41418716 GGCAGTGTGGGGAGGCAGTGTGG - Intronic
990336185 5:54774985-54775007 GCCAGGGTGGGGTGGCAGGGCGG - Intergenic
993517575 5:88857044-88857066 GCCAGGATTGGGGGGCTGGGGGG + Intronic
993702592 5:91135862-91135884 CCCAGTATGGGGTGGTGGGGAGG + Intronic
996898952 5:128521358-128521380 GCCTGTCTGGGGAGGGCAGGGGG + Intronic
997250731 5:132386776-132386798 GCCAGCATGGGGATGCCGTCAGG + Intronic
997879758 5:137579152-137579174 GCCAGTATGGGGAGGGAGGAGGG - Intronic
1001458159 5:171883377-171883399 CCCAGTGTGGGGAGGCGGGAGGG + Intronic
1002795896 6:470906-470928 GCCAGGGTGCGGAGGCTGGGCGG + Intergenic
1003304727 6:4916015-4916037 GGCAGGATGGGGTGGCGGGGTGG - Intronic
1003498710 6:6686954-6686976 GCCGGTAATGGGAGGCCTGGAGG - Intergenic
1003961200 6:11210960-11210982 GCCAGGATGGGGAGGGCAAGAGG - Intronic
1003961340 6:11211898-11211920 GCCAGGATGGGGAGGGCAGGAGG + Intronic
1004903253 6:20212597-20212619 GCCAGGCTGGGCGGGCCGGGCGG - Intergenic
1005549381 6:26898250-26898272 GACAGTGTGGGAAGGCCGTGAGG - Intergenic
1005549731 6:26899887-26899909 GACAGTGTGGGAAGGCCGTGAGG - Intergenic
1005621932 6:27628349-27628371 GCCAGTTTTGGGATGCCGGGTGG - Intergenic
1005841054 6:29744831-29744853 TCCAGGATGGGCAGGCTGGGAGG + Intergenic
1005990023 6:30896852-30896874 GCCAGTTTGGGGAGGTAAGGAGG + Exonic
1006059818 6:31411653-31411675 TCCAGGATGGGCAGGCTGGGAGG - Intronic
1006072310 6:31506724-31506746 TCCGGGATGGGCAGGCCGGGAGG - Intronic
1006451941 6:34110431-34110453 GCCAGTGTGGCCAGGTCGGGTGG - Intronic
1007201654 6:40114752-40114774 ACCAATATGGGGTGCCCGGGAGG - Intergenic
1007630632 6:43271177-43271199 GCCTGTATGGGGAGGGGAGGAGG + Intronic
1007787716 6:44290800-44290822 GCCAGTATGGTGAAGCTGGATGG - Intronic
1007796498 6:44352839-44352861 GACACTCTGGGGAGGCCAGGAGG - Exonic
1010629887 6:78186683-78186705 ACTAGTATGGGGAGGCAGGGAGG - Intergenic
1010795897 6:80115882-80115904 TCCAGCATTGGGAGGCCGAGGGG - Intronic
1012965186 6:105666387-105666409 TCCAGCATGGGATGGCCGGGAGG + Intergenic
1018908077 6:168086722-168086744 AGCAGTATGGGGATGCCGAGGGG - Intergenic
1019297005 7:282880-282902 GCCAGGATGGGGGCGCCCGGAGG - Intergenic
1019700728 7:2474076-2474098 GCCAGGAGGGGCAGGCCTGGGGG + Intergenic
1019803459 7:3105330-3105352 GCCAGAGTGGGAAGGTCGGGTGG - Intergenic
1020009421 7:4800132-4800154 GCCAGTATGGGGGTGCGGCGAGG + Intronic
1020122716 7:5513991-5514013 GCCGGCATCGGGAGGCCGGGTGG - Intergenic
1020274321 7:6615560-6615582 GACAGGATGCGGATGCCGGGGGG + Intergenic
1021658968 7:22899226-22899248 GACAGCATGGGGAGTCTGGGTGG - Intergenic
1027987581 7:85313568-85313590 GACAGAATGGGGAGGTGGGGTGG - Intergenic
1028514044 7:91656792-91656814 GCCAGTGTGGGGTGGGCAGGTGG - Intergenic
1029612353 7:101633825-101633847 GCCAGAAAGGGCAGGCCGTGAGG - Intergenic
1031264301 7:119564955-119564977 GACAGTATGGGCAGACAGGGAGG + Intergenic
1032698995 7:134362354-134362376 GCCAGTATGGGGAGCATGGATGG - Intergenic
1033142493 7:138840172-138840194 GCCAGTATGGGGGGCCAGGCTGG - Exonic
1034019491 7:147626440-147626462 GCCACTGTGGGGATGCAGGGTGG - Intronic
1034468299 7:151242655-151242677 ACCAGGATGGGGAAGCAGGGTGG - Intronic
1034549939 7:151814029-151814051 GCCAGGGTGGGAAGGCAGGGAGG + Intronic
1035830390 8:2688766-2688788 GCCAGGAGGGCCAGGCCGGGGGG - Intergenic
1037892121 8:22628945-22628967 CCCACTCTGGGGAGGCTGGGGGG + Intronic
1038437260 8:27544789-27544811 GACAGAATGGGGTGGCCAGGTGG + Exonic
1038459433 8:27703429-27703451 GACAGGATGGGGTGGCTGGGTGG + Intergenic
1038897724 8:31804617-31804639 GCCTGTAGGGGGAGGCCTGCAGG + Intronic
1040290571 8:46122035-46122057 GCCAAAATGGGGACGCAGGGTGG - Intergenic
1040312504 8:46244012-46244034 GAGACTATGGGGAGGCAGGGTGG + Intergenic
1040334263 8:46408130-46408152 GCGAAAATGGGGAGGCAGGGTGG + Intergenic
1047256527 8:123217388-123217410 GCCAGGAAGGCGAGGCGGGGCGG + Intergenic
1049619154 8:143590007-143590029 ACAAGTATGAGGAGGCCGAGCGG - Exonic
1049687358 8:143944293-143944315 GACAGCAGGGGGAGGCTGGGAGG - Intronic
1051343484 9:16131835-16131857 GCCAGTACTGAGAGGCCTGGTGG - Intergenic
1051879961 9:21829751-21829773 GCCAGCATGAGCAGGGCGGGGGG + Intronic
1054788629 9:69234199-69234221 GGCAGTATGGGGAGGCAGGAAGG + Intronic
1055481451 9:76712476-76712498 GCTAGGATGGGGAGGGTGGGTGG + Intronic
1057038507 9:91830598-91830620 CCCAGTTTGGGGAGGCTGGTGGG - Intronic
1057164357 9:92914388-92914410 GACAGCAAGGGGAGGCTGGGTGG + Intergenic
1057943736 9:99306627-99306649 GCCAGGAGGGGCAGGCGGGGTGG - Intergenic
1058162134 9:101581225-101581247 GGCAGGATGGGGAGGTTGGGTGG + Intronic
1060856198 9:126915768-126915790 GCCAGGATGCGGGGGGCGGGGGG + Intronic
1061237623 9:129351830-129351852 GCCAGCAAGGGGGAGCCGGGAGG - Intergenic
1061402951 9:130378377-130378399 GCTGGGATGGGGAGGCTGGGAGG + Intronic
1061402968 9:130378413-130378435 GCTGGGAGGGGGAGGCCGGGAGG + Intronic
1061403032 9:130378574-130378596 GCTAGAATGGGGAGGCGGGGAGG + Intronic
1061469625 9:130813997-130814019 GCCAGTGTGGCCAGGCAGGGAGG + Intronic
1061857617 9:133450884-133450906 TGCAGTGTGGGGAGGCCTGGGGG + Intronic
1062041238 9:134405212-134405234 GCCAGGATGGGGAGGCCAGGCGG - Intronic
1062172775 9:135144685-135144707 GCCACCATGGGGAGCCGGGGAGG - Intergenic
1062390354 9:136331370-136331392 GCCAGCATGGGGCAGCGGGGGGG - Intronic
1062494481 9:136825370-136825392 TCCAGTATGCTGAGGCCAGGAGG + Intronic
1062571697 9:137188791-137188813 GCCGGGACGGGGAGGTCGGGAGG + Intronic
1062600936 9:137318327-137318349 GCCATTATGGGGGGGACGAGGGG - Intronic
1062637902 9:137501149-137501171 GTCAGTATGCGGGTGCCGGGAGG - Intronic
1186101240 X:6158792-6158814 GCCTGTCTGGGGATGCCCGGAGG - Intronic
1188428840 X:30082242-30082264 CTCAGAATGGGGAGGCTGGGAGG - Intergenic
1192274432 X:69615791-69615813 GCCAGTACGGGGAGGAAAGGAGG - Intergenic
1194227542 X:91279720-91279742 GCCAGGATGGGGAGGATGAGTGG + Intergenic
1196116752 X:112007033-112007055 TCCAGTATAGGGAGGTGGGGTGG + Intronic
1198337819 X:135684624-135684646 GCCTGTCAGGGGAGGCCTGGGGG + Intergenic
1198814356 X:140571970-140571992 GCCAGTAAGGGTTGGCAGGGAGG - Intergenic
1199967158 X:152830369-152830391 GGCAGAATGAGGAGGCCAGGGGG + Intronic
1199991625 X:152990548-152990570 GCCATCAGGGAGAGGCCGGGGGG - Exonic
1200134855 X:153869920-153869942 GCCAGTACGGGGCAGCTGGGAGG + Exonic