ID: 1068783142

View in Genome Browser
Species Human (GRCh38)
Location 10:60943597-60943619
Sequence AAGGCCAGTATGGGGAGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 251}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068783142_1068783153 7 Left 1068783142 10:60943597-60943619 CCCGGCCTCCCCATACTGGCCTT 0: 1
1: 0
2: 0
3: 26
4: 251
Right 1068783153 10:60943627-60943649 GAAGCGCCTTCTCGTCGGCGCGG No data
1068783142_1068783152 2 Left 1068783142 10:60943597-60943619 CCCGGCCTCCCCATACTGGCCTT 0: 1
1: 0
2: 0
3: 26
4: 251
Right 1068783152 10:60943622-60943644 AAGGGGAAGCGCCTTCTCGTCGG No data
1068783142_1068783155 24 Left 1068783142 10:60943597-60943619 CCCGGCCTCCCCATACTGGCCTT 0: 1
1: 0
2: 0
3: 26
4: 251
Right 1068783155 10:60943644-60943666 GCGCGGCACCACCCCCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068783142 Original CRISPR AAGGCCAGTATGGGGAGGCC GGG (reversed) Intronic
900438124 1:2641055-2641077 AAGGGAGGTATGGGGAGGGCTGG + Intronic
900438134 1:2641079-2641101 AAGGGAGGTATGGGGAGGGCTGG + Intronic
900553030 1:3265933-3265955 AAGCCCAGGAGGGCGAGGCCAGG + Intronic
900558681 1:3292746-3292768 AAGGGAAGAATGGGGAGCCCAGG + Intronic
900587763 1:3441465-3441487 AGGGCCATTATGGGGAGGTTGGG - Intergenic
900968376 1:5975447-5975469 AAGGACAGTGTGGTGTGGCCAGG - Intronic
901344799 1:8530488-8530510 AAAGCCAAAATGGGGAGGCGGGG + Intronic
901924883 1:12559917-12559939 AAGGCCAGTTCAGGGAGGCCTGG - Intergenic
902714863 1:18265680-18265702 AAGGCAAGCATGTGGAGGTCAGG - Intronic
902870013 1:19308301-19308323 CAGACCAGGAAGGGGAGGCCAGG + Intronic
903174848 1:21574784-21574806 AAGGCCAGGATGGGCCGCCCAGG + Intronic
903501190 1:23800852-23800874 ACGGCCACTACGGGGAGGGCGGG + Intergenic
904662349 1:32094735-32094757 GAGGCCATTATGGGGATCCCAGG + Intronic
905146112 1:35887924-35887946 AAGGCCAGGCTGGAGAGGGCAGG - Intronic
905166995 1:36088674-36088696 AAGGCCACTATGGGGTCTCCGGG - Intergenic
907323105 1:53618090-53618112 AAGCCCAGAAAGGGCAGGCCTGG + Intronic
907725572 1:57017261-57017283 AAGGCTAGTTTTGAGAGGCCAGG - Intronic
907803162 1:57791734-57791756 AAGGTGAGTGTGGGGAGCCCGGG - Intronic
908569076 1:65389781-65389803 AAGGCCAGGATAGGAAGGCCAGG + Intronic
909670404 1:78182210-78182232 ATGGCCAGTATGGGGAGAGGAGG + Intergenic
912492517 1:110070136-110070158 AAGGCCAGTGTGGGGCGGGAGGG - Intronic
914789907 1:150868604-150868626 AAGACCAGCCTGGGCAGGCCGGG + Intronic
915214209 1:154329149-154329171 AAGGCAGGTAGGGGGAGGCTGGG - Intronic
915485880 1:156220257-156220279 AAGACCAGCATGGGCAGGCCGGG - Intronic
915533840 1:156521956-156521978 AAGACCAGCCTGGGAAGGCCAGG - Intergenic
917080842 1:171255662-171255684 GAGGCCAGTAGAGGGGGGCCTGG - Intronic
919735586 1:200948244-200948266 AAGGCCAGAAGAGGGGGGCCGGG + Intergenic
919837064 1:201582384-201582406 AGGACCAGTATGGGAAGGGCTGG + Intergenic
922477528 1:225916820-225916842 CAGGCCTGTCTGGGGAGGCCAGG - Intronic
922720026 1:227895624-227895646 GAGGCCAGGATGGCGAGACCAGG + Intergenic
923158220 1:231296780-231296802 AAGGCCCATAGGGGAAGGCCAGG - Intergenic
923158820 1:231300381-231300403 AAAGCCAGTAGGGTAAGGCCAGG - Intergenic
923159066 1:231301919-231301941 AAGGCCAGTAGGGTAAGGCCAGG - Intergenic
923275335 1:232390429-232390451 AAGGCCATTATGAGAAGTCCTGG - Intergenic
924188307 1:241519548-241519570 AAGGTCACTGCGGGGAGGCCGGG + Intronic
1064469804 10:15624545-15624567 AAGTCCAGTCTGGTGAAGCCAGG - Intronic
1066241889 10:33545480-33545502 AATGCCAGTATGGTGAGCCTTGG + Intergenic
1066649417 10:37640461-37640483 CAGGCCTGACTGGGGAGGCCCGG + Intergenic
1068044688 10:51871431-51871453 AGGATCAGGATGGGGAGGCCAGG - Intronic
1068783142 10:60943597-60943619 AAGGCCAGTATGGGGAGGCCGGG - Intronic
1069628823 10:69884841-69884863 CAGAACAGAATGGGGAGGCCAGG + Intronic
1069894072 10:71669741-71669763 AAAATCAGAATGGGGAGGCCAGG - Intronic
1074293130 10:112156485-112156507 AAGGCCATTTAGGGGAGGCAGGG - Intronic
1074480639 10:113817199-113817221 AAGCCAAGTATTTGGAGGCCTGG + Intergenic
1075398320 10:122143416-122143438 GAGGCCTGGATGGGGAAGCCGGG + Intronic
1075637251 10:124037660-124037682 ACAGCCACTATGGGGCGGCCTGG - Intronic
1076429277 10:130390374-130390396 AAGACCACTATGAGGAAGCCTGG + Intergenic
1077229021 11:1450459-1450481 AAGGCCAGTGGCGGGAGGCCGGG - Intronic
1078947422 11:16085248-16085270 AATCCCAGTATGGTGAGGACTGG + Intronic
1083326942 11:61877744-61877766 AAGGGCAGCCTGGGGAGGCTTGG - Intronic
1083408849 11:62477989-62478011 AAGGCCAGGGTGGTGAAGCCCGG + Intronic
1083417537 11:62535351-62535373 AAGGCCAATTTGTGGGGGCCAGG + Intronic
1084960675 11:72714619-72714641 AAGACCAGAATGGGGAGTCAGGG + Intronic
1085477499 11:76797371-76797393 AAGGGCAGCAAGGGGAGCCCAGG - Exonic
1085519495 11:77129809-77129831 AGGGCCAGTGTGTGAAGGCCAGG + Intronic
1086059240 11:82683194-82683216 AAGGCCAGAGTGGGAGGGCCAGG - Intergenic
1088585192 11:111355126-111355148 GTGGCCAGCATGGGGAGGCCTGG + Intronic
1089401652 11:118167994-118168016 CAGGGCACTTTGGGGAGGCCAGG - Intronic
1090101576 11:123803156-123803178 GAGATCAGTTTGGGGAGGCCAGG - Intergenic
1090992051 11:131826640-131826662 AAGGCCAGGAGTGGGAGGGCTGG + Intronic
1091040907 11:132280442-132280464 CAGGACAGTGTGGTGAGGCCAGG - Intronic
1091701429 12:2665853-2665875 AGGGCCAGCAGGAGGAGGCCCGG + Intronic
1092380789 12:7995362-7995384 AAGGCCAGTACTGGGAGGGATGG + Intergenic
1093934023 12:24982194-24982216 AAGGCCATTATGGGAAGGGGTGG + Intergenic
1094222889 12:28013240-28013262 AAGGCCAGAATGTGAAGGTCTGG - Intergenic
1094680699 12:32664523-32664545 AATCTCAGTAAGGGGAGGCCTGG + Intergenic
1096460639 12:51819999-51820021 AGGGCCAGCATGGGGTGGGCAGG + Intergenic
1096836599 12:54355249-54355271 AAGGCCACTAGGGAGGGGCCAGG + Intergenic
1100230696 12:92603821-92603843 AAGGCCAGTAGGGGGTGCCATGG - Intergenic
1101308788 12:103557422-103557444 AAGTCCCGTATGGTGTGGCCTGG - Intergenic
1101808852 12:108090673-108090695 AAGGCTAGGGTGGGAAGGCCAGG - Intergenic
1101835103 12:108289527-108289549 CAGGCCAGGATGGGGGAGCCAGG - Exonic
1102625991 12:114235870-114235892 AAGGGCAGCTTGGGGAGGGCTGG + Intergenic
1103209967 12:119158534-119158556 AGGCCCGGTATGGGGAGGCTGGG - Exonic
1104313987 12:127680073-127680095 AAGGCCTGGAAAGGGAGGCCTGG - Intergenic
1104928205 12:132324695-132324717 AAGGCAAGTGTTGGGTGGCCTGG + Intronic
1105686659 13:22789929-22789951 AAGACCAGCATGGTGAGGACAGG + Intergenic
1107400021 13:40060552-40060574 AAGACCAGTTTGGGCAGGCCTGG + Intergenic
1113626238 13:111849926-111849948 AGAGCCAGTAGGGCGAGGCCAGG - Intergenic
1113878402 13:113608634-113608656 AAGGCCAGAAGGGTAAGGCCAGG - Intronic
1114303080 14:21395635-21395657 AATGCCAGTAGGGGGAGATCAGG - Intronic
1115128021 14:30019363-30019385 AAGGCCCGTAAGAGGAGGCCTGG - Intronic
1118608293 14:67519355-67519377 AAGGCCAGTTTTGGGAATCCAGG + Intronic
1118727278 14:68638097-68638119 AAGGCCAGTGAAGGAAGGCCTGG + Intronic
1119049954 14:71357483-71357505 AATCCCAGTATGGGGAATCCAGG - Intronic
1119506426 14:75176844-75176866 ATGGCAAGTATGGGCAGCCCTGG + Intergenic
1119894355 14:78207157-78207179 AAGTCCAATGTGGGGAGGCCGGG - Intergenic
1121338625 14:93092172-93092194 AAGCCCAGCATGGGGAGGGTGGG + Intronic
1121432912 14:93900099-93900121 AAGGACAGTGTGGGGACTCCCGG + Intergenic
1122418924 14:101563523-101563545 AAGGTCACTATGGGGACGCGAGG - Intergenic
1122748769 14:103917673-103917695 CAGGCAAGAATGGGGAGGCCAGG + Intronic
1122941781 14:104984756-104984778 GGGGCCAGTCTGGGAAGGCCAGG + Intergenic
1123034732 14:105467276-105467298 AAGCCTAGCATGAGGAGGCCAGG + Intronic
1125330743 15:38579855-38579877 AAGGCCTGTCTGGGGAGGAGAGG + Intergenic
1126232729 15:46345717-46345739 AAGGCCAGGATGACCAGGCCAGG - Intergenic
1127902283 15:63349754-63349776 AAGGACAGCGTGGGGAAGCCAGG - Intronic
1128241071 15:66101326-66101348 AGGCCCAGTGTGGGGAGGGCAGG - Intronic
1128977969 15:72167183-72167205 ATGGCCACCATGGGGAAGCCTGG + Intronic
1129247635 15:74289336-74289358 CAGGCCAGAATGGGAAGGGCTGG + Intronic
1129326517 15:74802767-74802789 AAGGCGAGTGGCGGGAGGCCAGG - Exonic
1129483073 15:75843266-75843288 AAGGCGAGGAGGGGGCGGCCGGG + Exonic
1129867802 15:78922590-78922612 AAGGCTGGCATGGGGCGGCCTGG - Intronic
1129974019 15:79805895-79805917 AGGGCAAGTATGATGAGGCCTGG - Intergenic
1130753666 15:86740229-86740251 AATCCCAGTATGGGGATGCTAGG - Intronic
1131552056 15:93365609-93365631 GAAGCCAGGATGGGGAGCCCAGG + Intergenic
1132539751 16:503218-503240 ATGGACAGTCTGGGGAGCCCTGG - Intronic
1132810338 16:1794013-1794035 GAGGCCGGTTTGGGGAGCCCAGG + Intronic
1132891343 16:2206284-2206306 AAGGCCAGATGGTGGAGGCCTGG + Intronic
1133788432 16:8990675-8990697 AATCCCAGCATTGGGAGGCCAGG + Intergenic
1134211247 16:12279451-12279473 AAAGCCAGGCTGGGGAGGCCTGG + Intronic
1136569352 16:31087606-31087628 CAGGCCAGTGTGAGGAGGCAAGG - Exonic
1139282873 16:65785082-65785104 AAGGGCAGTCTGGGAAAGCCAGG + Intergenic
1139349793 16:66327827-66327849 AAGACCAGTATGGTCAGGGCTGG - Intergenic
1139474223 16:67194533-67194555 GGGGCAAGTAGGGGGAGGCCTGG + Intronic
1140257956 16:73352890-73352912 CAAGCCAGTTTAGGGAGGCCAGG - Intergenic
1141056014 16:80815091-80815113 GAGGCCTGTTGGGGGAGGCCGGG - Intergenic
1141227853 16:82136217-82136239 AAGGCTTGTTTGTGGAGGCCTGG - Intergenic
1141697289 16:85626091-85626113 AAGTCCAGTATGGGGACCCAGGG + Intronic
1141762594 16:86038633-86038655 CAGGCCAATGCGGGGAGGCCTGG - Intergenic
1141804624 16:86334638-86334660 AAGGCCACTGTGAGGAGGCTGGG + Intergenic
1144855101 17:18263183-18263205 AAGGGCAGCAGGTGGAGGCCGGG - Exonic
1146643897 17:34563630-34563652 AAGACCAGGTTGGGGAGGGCTGG - Intergenic
1146730943 17:35193637-35193659 AAGGCCACTGTTGGGAGGCAGGG + Exonic
1146756095 17:35433188-35433210 CAGCCCAGGATGGGGAGGGCCGG - Exonic
1149774914 17:59349635-59349657 AAGGCCAGCCTGTGGGGGCCGGG - Intronic
1151080147 17:71320261-71320283 AAGTCCAGTAAAGAGAGGCCAGG - Intergenic
1151192925 17:72411866-72411888 GATGTCAGTATGGGGAGGCAAGG + Intergenic
1151478931 17:74358852-74358874 AAGGCCAGAATGAGGGAGCCTGG - Intronic
1151671892 17:75575453-75575475 AAGGCCAGCCAGGGGCGGCCAGG - Intergenic
1151727180 17:75891976-75891998 CAGGACAGCAGGGGGAGGCCTGG + Intronic
1152571665 17:81123772-81123794 CAGGCCAGCATGGGCAGGGCTGG + Intronic
1153585090 18:6612694-6612716 AAGGCAAGAATGGGGAAACCGGG - Intergenic
1155051740 18:22154220-22154242 AAGGCCAGTATGTTGGGGGCCGG + Intergenic
1157532085 18:48429687-48429709 AAGGCCAGGCTGGGGAGGTGGGG + Intergenic
1160871178 19:1278636-1278658 GAGGCCAGTGGGGGGAGGCTGGG + Intronic
1161431235 19:4233504-4233526 AAGGACAGACTGTGGAGGCCAGG - Intronic
1162793166 19:13073367-13073389 AAGGCCAGAAGGGGGCTGCCTGG - Intronic
1163254750 19:16148901-16148923 AAGGACAGGGTGGGGAGGGCAGG - Intronic
1163563938 19:18038482-18038504 AAGACCAGCCTGGGCAGGCCAGG - Intergenic
1163610864 19:18300936-18300958 CAGACCAGGTTGGGGAGGCCGGG - Intergenic
1163648947 19:18506009-18506031 AGGGCCAGCATGGGGGGCCCAGG - Intronic
1163722883 19:18906597-18906619 AGGGCCGGTATGGGGGGCCCGGG + Intronic
1164412249 19:28015680-28015702 GAGGAAAGGATGGGGAGGCCAGG - Intergenic
1165432581 19:35781061-35781083 CAGGCCAGGATGGTGAGGCCGGG + Exonic
1165929743 19:39349413-39349435 AAGTACAGTATGGGGAGCTCCGG - Intronic
1167867110 19:52337281-52337303 AACCACAGCATGGGGAGGCCTGG + Intronic
1168317066 19:55489072-55489094 ATGGGCAGAAGGGGGAGGCCTGG - Intronic
1168535218 19:57163371-57163393 GAGGATTGTATGGGGAGGCCAGG - Intronic
925323193 2:2992976-2992998 GAGGCCAATGTGGGGAGGTCTGG - Intergenic
928135874 2:28687069-28687091 TAGACCGGTTTGGGGAGGCCAGG + Intergenic
929444915 2:41994104-41994126 CAGGCCAATATCAGGAGGCCTGG + Intergenic
933689094 2:85165622-85165644 AAGACCTGTTTGGGGCGGCCTGG + Intronic
935230628 2:101092804-101092826 AAAGCCAGTACGGGGAAGCCAGG + Intronic
935822583 2:106909054-106909076 AAGGGCAGTCTGGGGTGGCCTGG - Intergenic
937314012 2:120919709-120919731 GTGGCCAGGATGGGGAAGCCCGG - Intronic
938625579 2:133105536-133105558 AAGGCCAGTTTTGAGAGGCAAGG - Intronic
939082250 2:137676142-137676164 AAGACCAGCAGGGTGAGGCCTGG + Intronic
940012533 2:149070160-149070182 GAGGCCAGTGTGGTGAAGCCTGG - Intronic
941889815 2:170568323-170568345 AAGGCCAGTGATGGAAGGCCAGG + Intronic
942710628 2:178830956-178830978 GAGGCCAGAGAGGGGAGGCCAGG + Exonic
948147287 2:235717054-235717076 AAGGGCAGTGTGGGGAGACCTGG - Intronic
948231385 2:236351771-236351793 CAGGGCAGGATGGGGAGGGCAGG + Intronic
948264300 2:236626063-236626085 CAGGCCAGTGTGGGGAGGAAAGG + Intergenic
948629101 2:239290791-239290813 TAGGGCACTATGGGGAGGGCCGG + Intronic
1168865939 20:1086593-1086615 AAGCCCAGTGTGGGGAGGGGAGG + Intergenic
1172149476 20:32780056-32780078 CAGGACAGAGTGGGGAGGCCAGG - Intronic
1173311328 20:41898610-41898632 AAGGCCAGTTGGGAGAGGCAAGG + Intergenic
1175119653 20:56708224-56708246 TAGGCCAGGATGGGGATGGCAGG + Intergenic
1175119679 20:56708306-56708328 TAGGCCAGGATGGGGATGGCAGG + Intergenic
1175119694 20:56708347-56708369 TAGGCCAGGATGGGGATGGCAGG + Intergenic
1175767847 20:61603502-61603524 AGGGCCAGGCTGTGGAGGCCAGG + Intronic
1175788338 20:61725766-61725788 AAGGCGAGGAAGGGGAGGGCTGG + Intronic
1175862781 20:62159134-62159156 AGGAGCAGTGTGGGGAGGCCTGG + Intronic
1176422270 21:6525733-6525755 AAAGCCTGTTTGTGGAGGCCTGG - Intergenic
1178467887 21:32865283-32865305 AAGGCCAGTAGGAGGTGGGCAGG + Intergenic
1179697761 21:43134049-43134071 AAAGCCTGTTTGTGGAGGCCTGG - Intergenic
1181044246 22:20207114-20207136 AAGGCCAGGAAGGGGCGCCCAGG - Intergenic
1181574372 22:23784347-23784369 TCAGCCAGGATGGGGAGGCCTGG + Intergenic
1181728350 22:24827124-24827146 CAGCCCAGTGTGGGGAGGCAGGG + Intronic
1183087514 22:35495545-35495567 AGCCCCAGTATGAGGAGGCCTGG + Intergenic
1184093751 22:42305672-42305694 GAAGGCAGTCTGGGGAGGCCAGG - Intronic
953422405 3:42764720-42764742 AGGGCTGGGATGGGGAGGCCTGG - Intronic
953741907 3:45545570-45545592 AAGGCAACTCAGGGGAGGCCTGG + Intronic
953813322 3:46132860-46132882 AAGCCCAGTTTAGAGAGGCCAGG + Intergenic
954414256 3:50385231-50385253 AAAGCCAGACTGGGGAGGCAAGG + Intronic
954688115 3:52381608-52381630 AAGGCGAGGATGGGGAAGGCGGG - Intronic
956121067 3:65966499-65966521 AGGGCAACTATTGGGAGGCCAGG + Intronic
956284500 3:67594337-67594359 AAGGATAGTATGGTGAGGTCTGG - Intronic
964754581 3:160082128-160082150 AAGGCCAGTAGGGTAAAGCCAGG - Intergenic
964754841 3:160083667-160083689 AATGCCAGTAGGGTTAGGCCAGG - Intergenic
964755340 3:160086826-160086848 AAGGCCAGTAGGGTAAGGCCAGG - Intergenic
964755374 3:160087016-160087038 AAGGCCAATAGGTGAAGGCCAGG - Intergenic
964755613 3:160088704-160088726 AAGGCCAGTAGTGTAAGGCCAGG - Intergenic
966988364 3:185202977-185202999 AAGGCCAGGAAGGGGAGGGGGGG + Intronic
967269842 3:187724572-187724594 TAGCCCAGTATGGGGTGTCCAGG + Intronic
968234614 3:197024250-197024272 AAGGAAAGGAGGGGGAGGCCTGG + Intronic
969137532 4:5042725-5042747 AAGTCCAGTTTAGGGTGGCCAGG + Intergenic
969797793 4:9539708-9539730 GAGGCCAGTTTGGGGAGGAGGGG + Intergenic
972393459 4:38635088-38635110 AAAACCAGGTTGGGGAGGCCGGG + Intergenic
975708719 4:77137327-77137349 ATGGAAAGTCTGGGGAGGCCGGG + Intergenic
977296420 4:95214539-95214561 AAGGAAAGTATGGGGAGAGCAGG + Intronic
977995238 4:103492944-103492966 AAGGCCAGGAGGGTAAGGCCAGG + Intergenic
978576759 4:110196907-110196929 CCGGCCAGTGTCGGGAGGCCCGG - Intronic
985790658 5:1925389-1925411 AAGGCCATTCTGGGAAGCCCCGG - Intergenic
985883492 5:2658134-2658156 AAGGCCAGGGTGGGGAGACAGGG - Intergenic
987113346 5:14707624-14707646 GGGCCCAGGATGGGGAGGCCTGG - Exonic
995655768 5:114424608-114424630 AAGGGCAGTTCGGAGAGGCCAGG + Intronic
997986108 5:138502728-138502750 AAGACCAGCCTGGGGAGGCTGGG + Intergenic
999438093 5:151580129-151580151 AATGCCAGGATGGGGAGCCAGGG - Intergenic
999728912 5:154460849-154460871 AAGTACAATATGAGGAGGCCTGG - Exonic
1003080072 6:3014561-3014583 AAGGCCATTATAGAAAGGCCAGG - Intronic
1003961339 6:11211895-11211917 ATGGCCAGGATGGGGAGGGCAGG + Intronic
1004306088 6:14502951-14502973 CAGGGCAGTACAGGGAGGCCTGG + Intergenic
1005963677 6:30711570-30711592 AAGGCTAGTATGGGTAGGGTAGG - Intronic
1005990022 6:30896849-30896871 AGGGCCAGTTTGGGGAGGTAAGG + Exonic
1006234024 6:32611741-32611763 AATCCCAGAATTGGGAGGCCAGG - Intergenic
1009411816 6:63373943-63373965 AAGGCCAGGGTGGGGTGGCGGGG + Intergenic
1015274676 6:131371994-131372016 AAGCCCAGTTGGGGGTGGCCTGG + Intergenic
1016045356 6:139475378-139475400 AAGGCCAGCTTGCAGAGGCCTGG - Intergenic
1019429092 7:990533-990555 AAGGCCAGGACGTGGTGGCCGGG + Intergenic
1019532241 7:1509545-1509567 AAGACCAGAATGGGGTGGACAGG - Intergenic
1019762377 7:2822966-2822988 AATTCCAGTAATGGGAGGCCAGG - Intronic
1019852610 7:3574548-3574570 AAGGGCATAGTGGGGAGGCCAGG - Intronic
1020122717 7:5513994-5514016 TAGGCCGGCATCGGGAGGCCGGG - Intergenic
1023203067 7:37719907-37719929 AAGGCAAGGATGGGGGAGCCAGG + Intronic
1023910028 7:44547254-44547276 AAGGACAGGATGGGGAGGGGAGG + Intergenic
1026000721 7:66557738-66557760 ATGGCCAGTAGAGGGGGGCCGGG + Intergenic
1026856329 7:73757591-73757613 AAGGGCAGTTTGGGGAGCACAGG + Intergenic
1026896711 7:74013685-74013707 AGGGCTAGTATGGGGCGGACAGG - Intergenic
1026942226 7:74293768-74293790 CAGGCCAGTGTGGGGAGGAGAGG + Intronic
1028514045 7:91656795-91656817 AAAGCCAGTGTGGGGTGGGCAGG - Intergenic
1028561417 7:92179736-92179758 AAGGCCAGCAACTGGAGGCCAGG + Intergenic
1029032794 7:97486426-97486448 AAGCCCAGACTGAGGAGGCCTGG + Intergenic
1029459582 7:100687241-100687263 CAGGCCAGGGAGGGGAGGCCTGG - Intronic
1029571708 7:101374146-101374168 AAGGCCAGGCTGGGAAGGCCAGG - Intronic
1030792874 7:113750441-113750463 CAGGCCAGTATAGGGAGTCATGG - Intergenic
1032077866 7:128844602-128844624 AAGGCTGGGATGAGGAGGCCAGG + Intronic
1032408510 7:131675222-131675244 AAGGGCAGTTTGGGCAGGCCGGG + Intergenic
1034806891 7:154097090-154097112 GAGGCCAGCAAGGGGAGGCTGGG - Intronic
1035584510 8:761557-761579 AAGGCCAGTGTGGGGGATCCTGG + Intergenic
1037990186 8:23316360-23316382 AAGGCCAGGAAAGGGAGGGCTGG + Intronic
1038595621 8:28883092-28883114 AAGGCCAGTGAGAGGAAGCCTGG - Intronic
1041304578 8:56446498-56446520 AAGGCAAGTGTGAGGAGGGCGGG + Intronic
1041427571 8:57739516-57739538 ACGGCCAGTGGGGGGAGGCATGG - Intergenic
1043372699 8:79612230-79612252 GAGGCCAGCGTGGGGAGGGCGGG - Intronic
1048965195 8:139609831-139609853 GACGCCAGTGTGGGGAGGACTGG - Intronic
1049284912 8:141769385-141769407 GAGGCCTGTGTGGGGAGGACAGG - Intergenic
1049747776 8:144270255-144270277 CGGGCCAGCATGGGGAGGTCTGG + Intronic
1050829900 9:9997910-9997932 AAGGCTAGGATGGGAGGGCCAGG + Intronic
1051343485 9:16131838-16131860 AAGGCCAGTACTGAGAGGCCTGG - Intergenic
1052262915 9:26538764-26538786 AAGGCAAGTATAGGGAAGTCTGG + Intergenic
1055991092 9:82106513-82106535 AAGCCCAGGATGGGGAGTTCAGG + Intergenic
1056483346 9:87029269-87029291 AAGCCCAGTATTGGGATGGCTGG - Intergenic
1056495190 9:87148841-87148863 AAGGCCCGGGCGGGGAGGCCTGG + Exonic
1057893723 9:98889553-98889575 ATGGCCAGGGTGGGCAGGCCAGG - Intergenic
1058539396 9:105995753-105995775 AGGGCCAGGATGGGGACGCTGGG + Intergenic
1058748596 9:108016633-108016655 AAGGCCAGGCTGGGGAGGGCTGG + Intergenic
1059398469 9:114053756-114053778 AATGCCATTAGAGGGAGGCCTGG - Exonic
1060063330 9:120481200-120481222 AAGGTCAGGATGGTGAGGCCAGG + Intronic
1060485250 9:124042342-124042364 AGGGCCAGGAGGGGGAGGCAGGG - Intergenic
1060885612 9:127149969-127149991 AAGGCCAGGATGGGAAGGGAAGG + Intronic
1061002671 9:127911113-127911135 ACGGCCAGTATGGGTAGAACAGG + Intronic
1061234007 9:129331947-129331969 ATGACCAGTATGGGTCGGCCTGG - Intergenic
1061403031 9:130378571-130378593 GAGGCTAGAATGGGGAGGCGGGG + Intronic
1061405031 9:130388957-130388979 GCGGCCAGAATGGGGAGGCCTGG - Intronic
1062041239 9:134405215-134405237 TGTGCCAGGATGGGGAGGCCAGG - Intronic
1062119040 9:134824247-134824269 GAGGCCAGACTGGGGAGACCTGG + Intronic
1062394695 9:136348109-136348131 ACGGCCAGTAGGGTGAGCCCCGG + Intronic
1186347274 X:8706932-8706954 AAGGACAGTATGGGAAGGCTGGG - Intronic
1188074029 X:25753742-25753764 CAGGCCAGTATGGGAAGGCAGGG + Intergenic
1189273311 X:39767103-39767125 AAGGCCAAACCGGGGAGGCCTGG - Intergenic
1190301517 X:49059926-49059948 AAGGCAAGTATGCAGAGGGCAGG + Intronic
1190539423 X:51461859-51461881 AAGGCTAGGGTGGGAAGGCCAGG + Intergenic
1192070195 X:67930823-67930845 AAGGGCAGTATGGGGTTGGCGGG + Intergenic
1196682687 X:118484766-118484788 AGCCCAAGTATGGGGAGGCCAGG - Intergenic
1197753524 X:129980778-129980800 CAGGCCAGTCTGGCCAGGCCTGG - Intergenic
1199803405 X:151273318-151273340 AAGGCCAGTCTGAGCAGGCTTGG - Intergenic
1199851186 X:151725816-151725838 AAGGCCAGGAGGGGAAGACCAGG - Intergenic