ID: 1068783143

View in Genome Browser
Species Human (GRCh38)
Location 10:60943598-60943620
Sequence GAAGGCCAGTATGGGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068783143_1068783152 1 Left 1068783143 10:60943598-60943620 CCGGCCTCCCCATACTGGCCTTC No data
Right 1068783152 10:60943622-60943644 AAGGGGAAGCGCCTTCTCGTCGG No data
1068783143_1068783155 23 Left 1068783143 10:60943598-60943620 CCGGCCTCCCCATACTGGCCTTC No data
Right 1068783155 10:60943644-60943666 GCGCGGCACCACCCCCTCCCTGG No data
1068783143_1068783153 6 Left 1068783143 10:60943598-60943620 CCGGCCTCCCCATACTGGCCTTC No data
Right 1068783153 10:60943627-60943649 GAAGCGCCTTCTCGTCGGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068783143 Original CRISPR GAAGGCCAGTATGGGGAGGC CGG (reversed) Intronic
No off target data available for this crispr