ID: 1068783144

View in Genome Browser
Species Human (GRCh38)
Location 10:60943602-60943624
Sequence CTTCGAAGGCCAGTATGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 77}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068783144_1068783152 -3 Left 1068783144 10:60943602-60943624 CCTCCCCATACTGGCCTTCGAAG 0: 1
1: 0
2: 0
3: 8
4: 77
Right 1068783152 10:60943622-60943644 AAGGGGAAGCGCCTTCTCGTCGG No data
1068783144_1068783153 2 Left 1068783144 10:60943602-60943624 CCTCCCCATACTGGCCTTCGAAG 0: 1
1: 0
2: 0
3: 8
4: 77
Right 1068783153 10:60943627-60943649 GAAGCGCCTTCTCGTCGGCGCGG No data
1068783144_1068783155 19 Left 1068783144 10:60943602-60943624 CCTCCCCATACTGGCCTTCGAAG 0: 1
1: 0
2: 0
3: 8
4: 77
Right 1068783155 10:60943644-60943666 GCGCGGCACCACCCCCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068783144 Original CRISPR CTTCGAAGGCCAGTATGGGG AGG (reversed) Intronic
902770006 1:18640457-18640479 CTTCGAAAACCAGGAAGGGGCGG + Intronic
902919561 1:19657839-19657861 CTTCCAAGGCCAGAAGGAGGGGG + Exonic
903640515 1:24856772-24856794 CTTGGAAAGGCAGCATGGGGAGG + Intergenic
909742303 1:79045464-79045486 CTTCGAAGGCCGGCATGAGGCGG - Intergenic
913327859 1:117643155-117643177 CTTTGAAAGCCAGAATGTGGGGG - Intergenic
921193558 1:212730829-212730851 CTTAGAAGGTGAGTGTGGGGAGG - Intronic
921836865 1:219787309-219787331 CTCCAAAGGCCAGTAAGTGGTGG - Intronic
923170311 1:231410396-231410418 CTTCTAAGGCTTGAATGGGGAGG - Intronic
1065623801 10:27610415-27610437 TCTTGAAGGCCAGTATGGGATGG - Intergenic
1068421037 10:56793595-56793617 CTTCGGAGGCCAGAAGGGAGTGG + Intergenic
1068448336 10:57152697-57152719 CTGGGAAGGGCAGTAAGGGGAGG + Intergenic
1068783144 10:60943602-60943624 CTTCGAAGGCCAGTATGGGGAGG - Intronic
1070019775 10:72573225-72573247 TTTGGAAGGCCAATATGGGAGGG + Intronic
1070517950 10:77225550-77225572 CTCCGCAGGCCTGTGTGGGGAGG - Intronic
1073468997 10:103711317-103711339 CTTAGAAGGCCAGTAGGTGCAGG - Intronic
1075777380 10:124997508-124997530 CTTCAAATGCCAGGTTGGGGTGG - Intronic
1076564467 10:131388738-131388760 CTTGGGAGGCAAGAATGGGGTGG - Intergenic
1083457681 11:62789959-62789981 CTCCAGAGGCCGGTATGGGGTGG - Exonic
1091960705 12:4691798-4691820 CTGTGAGGGCCAGGATGGGGGGG + Exonic
1097874781 12:64632943-64632965 CTTTGAAGACCAGAATGTGGTGG + Intronic
1114337186 14:21702404-21702426 CTAAAAAGGCCATTATGGGGGGG - Intergenic
1116467634 14:45252483-45252505 CTTTGAAGGCCAGGATGAAGTGG + Intronic
1117947916 14:61049915-61049937 CTTAGTAGGCCAGTGTGTGGTGG - Intronic
1124003228 15:25776875-25776897 CTCTGAAGGCCAGGATGGAGAGG - Intronic
1129389632 15:75214111-75214133 CTGCCAAGGCCAGGTTGGGGTGG - Intergenic
1130961932 15:88665817-88665839 TTTGGAAGGCCAGGATGGGAGGG + Intergenic
1131448315 15:92518180-92518202 ATTAGAAGGCCAGTCTTGGGTGG - Intergenic
1132229485 15:100171105-100171127 CTTCAAAGGCCAGTTGGAGGAGG + Intronic
1137983141 16:53086491-53086513 CTTCCAAGGTTAGTCTGGGGCGG - Intronic
1139579627 16:67864767-67864789 CTTGAAAGCCCAGTAAGGGGAGG - Intronic
1141275712 16:82585965-82585987 CTTGGAAAGCCAGGATGGAGGGG + Intergenic
1141680065 16:85538641-85538663 CTTCGGAGGCCCCTGTGGGGAGG + Intergenic
1142192357 16:88723718-88723740 CTTGGGAGGCCTGGATGGGGCGG + Intronic
1144873095 17:18382521-18382543 CTGCGCAGGCCAGTATGGGCCGG + Exonic
1147743300 17:42680675-42680697 CTTGGAAGGCAAGTGTGGGCGGG - Intronic
1148780037 17:50116143-50116165 CTTCGGCTGCCAGTGTGGGGTGG + Intronic
1151748145 17:76022508-76022530 CTGCGCAGGCCAGTACGGGCCGG - Exonic
1152297883 17:79478971-79478993 CTTCAAAGGAGAGTGTGGGGAGG - Intronic
1163665711 19:18603306-18603328 CTTGGGAGGCCTGTCTGGGGAGG + Intronic
1165614006 19:37182739-37182761 TTAAGAAGGGCAGTATGGGGAGG - Exonic
1168671420 19:58243956-58243978 CTCAGAAGACCAGTCTGGGGTGG - Exonic
927015012 2:18950638-18950660 CTTCAAAGGGATGTATGGGGTGG + Intergenic
944443542 2:199766376-199766398 GTTCAAAGGCCAATATGGGAAGG - Intronic
945948168 2:216013810-216013832 CTTTGAAGGCCTGTAGGGGTGGG - Intronic
1172972607 20:38884358-38884380 CTTCAAAGTCCTGTATGGTGTGG - Intronic
1173772973 20:45679869-45679891 CTTTGTAGGCCAGAAGGGGGTGG - Intergenic
1174847651 20:53958890-53958912 CTTCTAGGGGCAGTATGGGGAGG - Intronic
1175862060 20:62155861-62155883 CTTCTAAGGACAGAATGGGGAGG - Intronic
1176264962 20:64204358-64204380 CTAAGAAGGGCAGTTTGGGGAGG - Intronic
1179778670 21:43685326-43685348 CATCGAAGCGCAGTGTGGGGAGG - Intronic
1180717161 22:17879600-17879622 CGTCGGAGGCCAGTGGGGGGTGG - Intronic
1181558544 22:23686260-23686282 CTTCGGAAGCCAGAATGGGCAGG + Intergenic
1183650339 22:39150024-39150046 CTAGGGAGGGCAGTATGGGGCGG - Intronic
1184639678 22:45863745-45863767 CTTCGAATGCCATCTTGGGGAGG - Intergenic
1185051940 22:48558728-48558750 GTTCAAGGGCCAGGATGGGGAGG + Intronic
953244222 3:41176101-41176123 CTTCGAAGTTCAGAATGGGGAGG + Intergenic
954003748 3:47577368-47577390 CTTCGAAGGACTGGATGGTGAGG - Exonic
954571499 3:51644752-51644774 CCTCCAAGGCCAGGATGCGGGGG + Intronic
954708302 3:52492919-52492941 CTTTGAAGAACAATATGGGGTGG - Exonic
957147394 3:76442021-76442043 CCTCAAAGGCAAGTAAGGGGTGG - Intronic
968733706 4:2284392-2284414 CTTTGAAGACCATGATGGGGAGG + Intronic
974805459 4:66874190-66874212 CTTCCAAGGCCAATTTGGTGGGG - Intergenic
982290236 4:153773519-153773541 CTTTGAAGGGCAGTATTGGGTGG + Intergenic
991725823 5:69535013-69535035 CTTGGAAGACCAGGATGAGGAGG + Intronic
991869131 5:71092842-71092864 CTTGGAAGACCAGGATGAGGAGG - Intergenic
1006209404 6:32382576-32382598 TTTCGAAGGCCAAGATGGGAGGG - Intergenic
1006575545 6:35042745-35042767 CTTCGCAGGACGGTGTGGGGAGG - Intronic
1007242259 6:40434825-40434847 CTTCTAAGGCCAGTAAGGTGGGG + Intronic
1007689801 6:43693018-43693040 CTTGGAAGGCTAAAATGGGGAGG + Intergenic
1007715214 6:43851793-43851815 CTTCCCATGCCAGAATGGGGTGG + Intergenic
1026605088 7:71808958-71808980 CTTATAAGGGCAGGATGGGGTGG - Intronic
1027987585 7:85313576-85313598 CTTGGGAGGACAGAATGGGGAGG - Intergenic
1028339595 7:89702343-89702365 CTTTAAAAGCCAGTATGGGATGG + Intergenic
1028986397 7:97012619-97012641 GTTCCAAGGGCAGTCTGGGGTGG - Intergenic
1035832386 8:2710842-2710864 CTTCCTAGGGCAGTGTGGGGCGG - Intergenic
1037882815 8:22581169-22581191 ATTAGAATGCCAGTGTGGGGTGG + Intronic
1042137909 8:65649793-65649815 CTGCAAAGGACAGTGTGGGGGGG - Intronic
1045073042 8:98530593-98530615 CTTAGAAGTCCAGTTTGGGGTGG + Intronic
1058486498 9:105447715-105447737 CCTCGAAGGATAGTGTGGGGAGG + Intergenic
1058765876 9:108182360-108182382 CTTCAAAAGCCACAATGGGGTGG - Intergenic
1059180812 9:112210484-112210506 CTAGGGAGGCCAGTAGGGGGTGG - Intergenic
1060169233 9:121447302-121447324 CTTCCAAGACCATTTTGGGGTGG - Intergenic
1060207572 9:121691225-121691247 CTTTACAGTCCAGTATGGGGTGG + Intronic
1060938832 9:127531719-127531741 CTATGAAGACCAGTATGGCGTGG - Exonic
1061204890 9:129157114-129157136 CTACAAAGGCCAGCATGGTGGGG + Intergenic
1196943125 X:120797360-120797382 CTTCCAAGCTCATTATGGGGAGG - Intergenic