ID: 1068783147

View in Genome Browser
Species Human (GRCh38)
Location 10:60943605-60943627
Sequence CCCCTTCGAAGGCCAGTATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 47}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068783147_1068783153 -1 Left 1068783147 10:60943605-60943627 CCCCATACTGGCCTTCGAAGGGG 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1068783153 10:60943627-60943649 GAAGCGCCTTCTCGTCGGCGCGG No data
1068783147_1068783155 16 Left 1068783147 10:60943605-60943627 CCCCATACTGGCCTTCGAAGGGG 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1068783155 10:60943644-60943666 GCGCGGCACCACCCCCTCCCTGG No data
1068783147_1068783152 -6 Left 1068783147 10:60943605-60943627 CCCCATACTGGCCTTCGAAGGGG 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1068783152 10:60943622-60943644 AAGGGGAAGCGCCTTCTCGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068783147 Original CRISPR CCCCTTCGAAGGCCAGTATG GGG (reversed) Intronic
900659674 1:3776282-3776304 CCCTTGTGAAGGCCAGGATGAGG + Intergenic
906860341 1:49352530-49352552 CCCCCTGGAAGGCCAGAAGGAGG - Intronic
907530654 1:55092587-55092609 CACTTTAGAAAGCCAGTATGTGG + Intronic
907796149 1:57719680-57719702 CCACTATGAAGGCCACTATGTGG + Intronic
909742305 1:79045467-79045489 GGCCTTCGAAGGCCGGCATGAGG - Intergenic
915952467 1:160198697-160198719 CCTCTGCGAAGGCCACAATGTGG - Exonic
1063578436 10:7282959-7282981 CCCATTCAAAGGCCGGTAAGAGG + Intronic
1063937353 10:11092127-11092149 GCCCTTCAGAGGCCTGTATGGGG - Intronic
1068783147 10:60943605-60943627 CCCCTTCGAAGGCCAGTATGGGG - Intronic
1078792942 11:14562815-14562837 CACTTTGGGAGGCCAGTATGTGG - Intronic
1079076084 11:17386339-17386361 CCCCTCCGAGGGCCAGTTTCAGG - Exonic
1079556830 11:21769252-21769274 CCCCAGGGTAGGCCAGTATGTGG - Intergenic
1089751903 11:120657680-120657702 CCCCTGCCATGGCCAGAATGGGG - Intronic
1091348056 11:134868535-134868557 CCCCTTCCCAGGCCTGTGTGTGG + Intergenic
1104685702 12:130782724-130782746 CCCCTGGGAAGGCCAGGAAGAGG - Intergenic
1121568698 14:94930349-94930371 CCCTTTCCAAGGCCAGACTGGGG - Intergenic
1132229482 15:100171102-100171124 ACCCTTCAAAGGCCAGTTGGAGG + Intronic
1132335058 15:101042927-101042949 CCCCTACGAGGGCCAGGCTGGGG + Intronic
1148238532 17:45984692-45984714 CCCCCTCCAATGCCAGCATGAGG - Intronic
1148238729 17:45986181-45986203 GCCCTTTGAAGACCAGTAAGTGG + Intronic
1163296942 19:16418532-16418554 CCCCATTGAAGGCCAGTAGCCGG - Intronic
1167612042 19:50512388-50512410 CCCCATCGAAGCCCAGGCTGGGG + Exonic
927894296 2:26771535-26771557 CCCCTGAGAAGGCCTGCATGAGG - Intronic
927971163 2:27307042-27307064 CGCCTTCGAAGCCCAGGCTGCGG - Exonic
928699743 2:33886453-33886475 TCCCTTCAAAGGACAGCATGAGG + Intergenic
939515584 2:143163850-143163872 CACCTTCGAAGGCAAGCCTGAGG + Intronic
947445285 2:230158182-230158204 CCCCCTCTGAGGCCTGTATGAGG - Intergenic
1169305952 20:4490471-4490493 CCCATTCTAAGGGCAGCATGTGG + Intergenic
1174227953 20:49020026-49020048 CCTCTTCAAAGGCTACTATGAGG - Intronic
1180600700 22:17013258-17013280 CCCCTTAAAGGGCCAGCATGGGG + Intergenic
1182744948 22:32598298-32598320 TGCCTTCTAAGGCCAGTGTGGGG - Intronic
1185345716 22:50309677-50309699 CCCCTTCACACGCCACTATGTGG + Exonic
954438448 3:50508521-50508543 TCCCTTCAGAGGCCAGGATGGGG - Intergenic
968837362 4:2975002-2975024 TCCCTTCAAAGACCAGAATGAGG + Intronic
969365303 4:6690602-6690624 CCCCCGGGAAGGCCAGGATGTGG - Intergenic
998177891 5:139913048-139913070 ACCCTTCCAAGCCCAGTCTGTGG + Intronic
998960770 5:147484128-147484150 TCCCTTCCAAGGCCAGTGTCTGG - Intronic
1001674465 5:173500507-173500529 CCCCTTGGAAGCTCAGGATGTGG + Intergenic
1004234826 6:13865291-13865313 CCCCTTGGAAGGAAAGTATCTGG + Intergenic
1011193778 6:84762914-84762936 CCCCTTCGACAGGCAGAATGTGG - Intronic
1019164831 6:170091250-170091272 CCCCTTGGAAGGACAGGAAGAGG - Intergenic
1019724275 7:2592549-2592571 CTCCGTCGAAGGCCAGTGTGTGG + Intronic
1032438639 7:131923474-131923496 CCACTACGAAGAACAGTATGGGG - Intergenic
1035474113 7:159129824-159129846 CCCCCTCAGAGGCCAGTTTGAGG - Intronic
1037882813 8:22581166-22581188 CCCATTAGAATGCCAGTGTGGGG + Intronic
1042040915 8:64587411-64587433 CACCCTCGAAGGACAGTTTGAGG - Intergenic
1049572561 8:143376118-143376140 CCCCAGGGAAGGCCAGGATGGGG - Intronic
1057165203 9:92920172-92920194 CCCATTGGCTGGCCAGTATGTGG + Intergenic
1060181591 9:121538131-121538153 CCCTTTAAAAGGCCAGTATCAGG - Intergenic
1061190568 9:129080531-129080553 CCCTTTCGCCGGCCAGTATGGGG + Intergenic
1189588385 X:42485414-42485436 TCCCTTGGAAGGCCAGTGTGAGG + Intergenic