ID: 1068783150

View in Genome Browser
Species Human (GRCh38)
Location 10:60943607-60943629
Sequence TTCCCCTTCGAAGGCCAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 49}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068783150_1068783152 -8 Left 1068783150 10:60943607-60943629 CCATACTGGCCTTCGAAGGGGAA 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1068783152 10:60943622-60943644 AAGGGGAAGCGCCTTCTCGTCGG No data
1068783150_1068783153 -3 Left 1068783150 10:60943607-60943629 CCATACTGGCCTTCGAAGGGGAA 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1068783153 10:60943627-60943649 GAAGCGCCTTCTCGTCGGCGCGG No data
1068783150_1068783155 14 Left 1068783150 10:60943607-60943629 CCATACTGGCCTTCGAAGGGGAA 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1068783155 10:60943644-60943666 GCGCGGCACCACCCCCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068783150 Original CRISPR TTCCCCTTCGAAGGCCAGTA TGG (reversed) Intronic
900273626 1:1808420-1808442 TTCACCTTAGCAGGCAAGTAAGG + Intronic
904870852 1:33617230-33617252 TTTCCCTTTGAAGGCCATCAGGG - Intronic
905368244 1:37467662-37467684 TTCCCCCTCCTAGGCCAGAAGGG + Intergenic
924140605 1:241019001-241019023 TTCCCCTGCGAAGGCCATGAGGG + Intronic
1068783150 10:60943607-60943629 TTCCCCTTCGAAGGCCAGTATGG - Intronic
1069891876 10:71657086-71657108 TTCTCCTTCCCAGGCCAGCAAGG + Intronic
1070720579 10:78754131-78754153 TTGCCCTTGGAAGTGCAGTATGG + Intergenic
1079837306 11:25350689-25350711 TTCCCCAACCAAGGGCAGTAAGG + Intergenic
1080720175 11:34840889-34840911 TTCCCCTTCACGGACCAGTAAGG + Intergenic
1094777064 12:33742340-33742362 TTACCCTTCGAATGCAAGCATGG + Intergenic
1098864304 12:75744649-75744671 TTCCCCTTGGAAGGACAGAGGGG + Intergenic
1101978015 12:109379000-109379022 TTCCAATTCAAAGGACAGTAAGG - Intronic
1109825426 13:67713892-67713914 TTCCTGTTCTAAAGCCAGTAAGG + Intergenic
1119643249 14:76330131-76330153 TTCCCCACCGCAGGCCAGGATGG + Intronic
1128310855 15:66631126-66631148 TTCCCCTTCCTAGGCCAGCTTGG - Intronic
1132999536 16:2841995-2842017 TTCCACATCGCAGCCCAGTAGGG - Intergenic
1142376586 16:89709866-89709888 TAGGCCTTCGAAGGCCAGAAGGG + Exonic
1145945502 17:28771068-28771090 TTTCCCTTAGAAGGCCAAGATGG - Intronic
1147190455 17:38735333-38735355 TCCCCCTTCGACAGCCAGTGGGG - Exonic
1147948044 17:44091603-44091625 TTCCCCTTCCAAGGCCCTAAGGG - Intronic
1148546168 17:48520647-48520669 TCCCCCTTCTAAGGTGAGTAAGG - Intergenic
1165771929 19:38385233-38385255 TTCCCCGTCAAAGGTCAGCATGG + Intronic
1168433641 19:56301329-56301351 CTCCCCTTTTTAGGCCAGTAGGG + Intronic
925336173 2:3100841-3100863 TTCCCCTTTCAAGCCCAGGAGGG - Intergenic
927512156 2:23650582-23650604 TTCACCTTGCAAGACCAGTATGG - Intronic
931823757 2:65978319-65978341 TTCCCCTTCGACTTCCATTATGG - Intergenic
934475615 2:94591524-94591546 CTCCCCTGCGGAGGCCAGGATGG - Intronic
942526186 2:176855586-176855608 TTCCCCTTCAAATTCCACTATGG - Intergenic
947220411 2:227786362-227786384 TTCTCCTTTTATGGCCAGTATGG + Intergenic
1168929992 20:1613765-1613787 TTCCCCCTGGAACTCCAGTAAGG - Intronic
1169404164 20:5309436-5309458 TTCCCTTTCCAAAGCCAGCAAGG + Intronic
1175121182 20:56717376-56717398 CTCCCCTTCAAGGGCAAGTAGGG + Intergenic
1175587228 20:60151006-60151028 TTCCCCTAGGAGGACCAGTAGGG + Intergenic
1178454325 21:32733340-32733362 TTCTACTTAGTAGGCCAGTAAGG + Intergenic
951051336 3:18097229-18097251 ATCTCCTTTGAAGGCCAGGAAGG + Intronic
964500151 3:157340012-157340034 TTTTCCTTCGAAAGTCAGTAAGG + Intronic
986457560 5:7934340-7934362 ATCCCCTTAGATGGCCAGTTGGG - Intergenic
989056524 5:37371148-37371170 TTCCTCTTCCCAGGCCAGAACGG - Exonic
994737109 5:103568933-103568955 TTCACATTCGAAGGACAATATGG + Intergenic
1003294478 6:4812318-4812340 TTCCCCATTGAAGGACATTAAGG + Intronic
1006267535 6:32937583-32937605 TTCCCCTTCAAGGGGCAGCATGG - Intronic
1008076341 6:47149776-47149798 GTCCACTTGGAATGCCAGTATGG - Intergenic
1024770092 7:52712475-52712497 TTCCCCTTTTCAGGTCAGTAAGG + Intergenic
1029667119 7:102002838-102002860 TTCCCCTTCCAAGGACTGGAAGG - Intronic
1046241495 8:111501395-111501417 ATCCACTTCAAAGGCCAGTAAGG + Intergenic
1055129577 9:72759467-72759489 TTCCTCTTCCTAGTCCAGTAAGG + Intronic
1061190565 9:129080529-129080551 TGCCCTTTCGCCGGCCAGTATGG + Intergenic
1187278490 X:17837438-17837460 TTCCCATTAGAAGCCCTGTAAGG - Intronic
1189742155 X:44130401-44130423 TTACCCTTTGAAGGACAGTTAGG + Intergenic
1194855450 X:98922181-98922203 TTCCCCTTTCTAGGCCAGTCAGG - Intergenic
1195035349 X:100966945-100966967 CTCCCCTTGGATGGCAAGTATGG + Intergenic
1195703343 X:107721306-107721328 TTCCCCTTCAAAAGCCAGACTGG + Intronic