ID: 1068783155

View in Genome Browser
Species Human (GRCh38)
Location 10:60943644-60943666
Sequence GCGCGGCACCACCCCCTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068783143_1068783155 23 Left 1068783143 10:60943598-60943620 CCGGCCTCCCCATACTGGCCTTC No data
Right 1068783155 10:60943644-60943666 GCGCGGCACCACCCCCTCCCTGG No data
1068783150_1068783155 14 Left 1068783150 10:60943607-60943629 CCATACTGGCCTTCGAAGGGGAA 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1068783155 10:60943644-60943666 GCGCGGCACCACCCCCTCCCTGG No data
1068783141_1068783155 27 Left 1068783141 10:60943594-60943616 CCGCCCGGCCTCCCCATACTGGC 0: 1
1: 0
2: 1
3: 20
4: 261
Right 1068783155 10:60943644-60943666 GCGCGGCACCACCCCCTCCCTGG No data
1068783142_1068783155 24 Left 1068783142 10:60943597-60943619 CCCGGCCTCCCCATACTGGCCTT 0: 1
1: 0
2: 0
3: 26
4: 251
Right 1068783155 10:60943644-60943666 GCGCGGCACCACCCCCTCCCTGG No data
1068783138_1068783155 29 Left 1068783138 10:60943592-60943614 CCCCGCCCGGCCTCCCCATACTG 0: 1
1: 1
2: 2
3: 59
4: 614
Right 1068783155 10:60943644-60943666 GCGCGGCACCACCCCCTCCCTGG No data
1068783149_1068783155 15 Left 1068783149 10:60943606-60943628 CCCATACTGGCCTTCGAAGGGGA No data
Right 1068783155 10:60943644-60943666 GCGCGGCACCACCCCCTCCCTGG No data
1068783139_1068783155 28 Left 1068783139 10:60943593-60943615 CCCGCCCGGCCTCCCCATACTGG 0: 1
1: 0
2: 1
3: 25
4: 264
Right 1068783155 10:60943644-60943666 GCGCGGCACCACCCCCTCCCTGG No data
1068783144_1068783155 19 Left 1068783144 10:60943602-60943624 CCTCCCCATACTGGCCTTCGAAG 0: 1
1: 0
2: 0
3: 8
4: 77
Right 1068783155 10:60943644-60943666 GCGCGGCACCACCCCCTCCCTGG No data
1068783151_1068783155 5 Left 1068783151 10:60943616-60943638 CCTTCGAAGGGGAAGCGCCTTCT 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1068783155 10:60943644-60943666 GCGCGGCACCACCCCCTCCCTGG No data
1068783147_1068783155 16 Left 1068783147 10:60943605-60943627 CCCCATACTGGCCTTCGAAGGGG 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1068783155 10:60943644-60943666 GCGCGGCACCACCCCCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068783155 Original CRISPR GCGCGGCACCACCCCCTCCC TGG Intronic
No off target data available for this crispr