ID: 1068783234

View in Genome Browser
Species Human (GRCh38)
Location 10:60943971-60943993
Sequence CTCGCGTCTCGCTCGGCTTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 37}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068783234_1068783246 10 Left 1068783234 10:60943971-60943993 CCTGAAGCCGAGCGAGACGCGAG 0: 1
1: 0
2: 0
3: 3
4: 37
Right 1068783246 10:60944004-60944026 CTTCAAGGGCCGGGGGGAGCGGG 0: 1
1: 0
2: 1
3: 13
4: 308
1068783234_1068783249 13 Left 1068783234 10:60943971-60943993 CCTGAAGCCGAGCGAGACGCGAG 0: 1
1: 0
2: 0
3: 3
4: 37
Right 1068783249 10:60944007-60944029 CAAGGGCCGGGGGGAGCGGGGGG 0: 1
1: 0
2: 5
3: 74
4: 713
1068783234_1068783248 12 Left 1068783234 10:60943971-60943993 CCTGAAGCCGAGCGAGACGCGAG 0: 1
1: 0
2: 0
3: 3
4: 37
Right 1068783248 10:60944006-60944028 TCAAGGGCCGGGGGGAGCGGGGG 0: 1
1: 0
2: 1
3: 30
4: 351
1068783234_1068783241 3 Left 1068783234 10:60943971-60943993 CCTGAAGCCGAGCGAGACGCGAG 0: 1
1: 0
2: 0
3: 3
4: 37
Right 1068783241 10:60943997-60944019 TCTCCGCCTTCAAGGGCCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 94
1068783234_1068783240 2 Left 1068783234 10:60943971-60943993 CCTGAAGCCGAGCGAGACGCGAG 0: 1
1: 0
2: 0
3: 3
4: 37
Right 1068783240 10:60943996-60944018 CTCTCCGCCTTCAAGGGCCGGGG 0: 1
1: 0
2: 0
3: 6
4: 106
1068783234_1068783247 11 Left 1068783234 10:60943971-60943993 CCTGAAGCCGAGCGAGACGCGAG 0: 1
1: 0
2: 0
3: 3
4: 37
Right 1068783247 10:60944005-60944027 TTCAAGGGCCGGGGGGAGCGGGG 0: 1
1: 0
2: 0
3: 17
4: 262
1068783234_1068783237 -4 Left 1068783234 10:60943971-60943993 CCTGAAGCCGAGCGAGACGCGAG 0: 1
1: 0
2: 0
3: 3
4: 37
Right 1068783237 10:60943990-60944012 CGAGCTCTCTCCGCCTTCAAGGG 0: 1
1: 0
2: 1
3: 7
4: 60
1068783234_1068783250 14 Left 1068783234 10:60943971-60943993 CCTGAAGCCGAGCGAGACGCGAG 0: 1
1: 0
2: 0
3: 3
4: 37
Right 1068783250 10:60944008-60944030 AAGGGCCGGGGGGAGCGGGGGGG 0: 1
1: 0
2: 10
3: 172
4: 2151
1068783234_1068783238 0 Left 1068783234 10:60943971-60943993 CCTGAAGCCGAGCGAGACGCGAG 0: 1
1: 0
2: 0
3: 3
4: 37
Right 1068783238 10:60943994-60944016 CTCTCTCCGCCTTCAAGGGCCGG 0: 1
1: 0
2: 0
3: 8
4: 145
1068783234_1068783242 4 Left 1068783234 10:60943971-60943993 CCTGAAGCCGAGCGAGACGCGAG 0: 1
1: 0
2: 0
3: 3
4: 37
Right 1068783242 10:60943998-60944020 CTCCGCCTTCAAGGGCCGGGGGG 0: 1
1: 0
2: 1
3: 3
4: 99
1068783234_1068783236 -5 Left 1068783234 10:60943971-60943993 CCTGAAGCCGAGCGAGACGCGAG 0: 1
1: 0
2: 0
3: 3
4: 37
Right 1068783236 10:60943989-60944011 GCGAGCTCTCTCCGCCTTCAAGG 0: 1
1: 0
2: 0
3: 11
4: 90
1068783234_1068783239 1 Left 1068783234 10:60943971-60943993 CCTGAAGCCGAGCGAGACGCGAG 0: 1
1: 0
2: 0
3: 3
4: 37
Right 1068783239 10:60943995-60944017 TCTCTCCGCCTTCAAGGGCCGGG 0: 1
1: 0
2: 0
3: 19
4: 158
1068783234_1068783245 9 Left 1068783234 10:60943971-60943993 CCTGAAGCCGAGCGAGACGCGAG 0: 1
1: 0
2: 0
3: 3
4: 37
Right 1068783245 10:60944003-60944025 CCTTCAAGGGCCGGGGGGAGCGG 0: 1
1: 0
2: 2
3: 22
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068783234 Original CRISPR CTCGCGTCTCGCTCGGCTTC AGG (reversed) Exonic
904199909 1:28812732-28812754 CTCGCCTCTCGCTGGGCCCCAGG - Intronic
912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG + Intergenic
922163342 1:223094542-223094564 CTGGCCTCTCCCTTGGCTTCTGG + Intergenic
1068783234 10:60943971-60943993 CTCGCGTCTCGCTCGGCTTCAGG - Exonic
1073450905 10:103608243-103608265 CCCGCCTCTCTCCCGGCTTCCGG - Intronic
1076567635 10:131409802-131409824 CTGGCCTCTCTCCCGGCTTCCGG - Intergenic
1077385818 11:2269096-2269118 CCGGCCGCTCGCTCGGCTTCCGG + Exonic
1080551327 11:33376180-33376202 CTCGCTCCTCGCTGGGCTTCGGG - Intergenic
1084146201 11:67266599-67266621 GCCGCGGCTCGCTCGGCCTCGGG - Exonic
1096788022 12:54029079-54029101 CTCGCCTCTCGCTCGCTTGCAGG + Intronic
1104812052 12:131625206-131625228 CTAGGGTCTCTGTCGGCTTCAGG + Intergenic
1113437936 13:110307511-110307533 CTCACCTCGGGCTCGGCTTCAGG - Exonic
1117756471 14:58979472-58979494 CTCCCCTGTGGCTCGGCTTCTGG + Intergenic
1118404737 14:65412445-65412467 CTCGCGCCCCGCTCAGCCTCCGG + Intronic
1125674581 15:41495324-41495346 CTCGCCTCTTCCTCGGCCTCAGG - Intronic
1139459504 16:67110358-67110380 CTCTCGGCTCGCTGGGCTCCAGG + Intronic
1139465137 16:67150365-67150387 CTCGCGGCGCGCTCGCCGTCGGG + Exonic
1147425004 17:40342174-40342196 CTGGCGACTCGCTCGGTCTCTGG - Intronic
1149570951 17:57672016-57672038 CCCGCCTCTAGCTAGGCTTCTGG - Intronic
1160859046 19:1230020-1230042 CCCGCGTCCCGCTCGGCGTCCGG + Exonic
1163578153 19:18122695-18122717 CTCGCGTCTCTCCCATCTTCCGG + Exonic
933971064 2:87469999-87470021 CCAGCCTCTCTCTCGGCTTCTGG - Intergenic
936322665 2:111480190-111480212 CCAGCCTCTCTCTCGGCTTCTGG + Intergenic
946088944 2:217203414-217203436 CTTGCCTCTCTCTTGGCTTCTGG + Intergenic
948221336 2:236272089-236272111 CTCATGTCACGCTCGGCTGCTGG + Intergenic
949074522 2:242046689-242046711 CTGGCGTCTCTCTCCGCTGCGGG - Intergenic
949074541 2:242046765-242046787 CTGGCGTCTCTCTCCGCTGCGGG - Intergenic
1176194630 20:63831436-63831458 CCCGCCCCTCGCTCGGCTCCCGG + Intergenic
950053968 3:10011050-10011072 CCCGCGGCTCCCGCGGCTTCCGG - Intronic
954382546 3:50227371-50227393 CTCCTGTCTCGCTCTGCCTCCGG - Intronic
976267412 4:83197139-83197161 TTTGGGTCTCGCTCAGCTTCAGG - Intergenic
976688272 4:87839996-87840018 CCCACATCTCGCTCTGCTTCAGG + Intronic
985713833 5:1445140-1445162 CTCGCGCCTCGGACGGCCTCAGG + Intronic
992350972 5:75928852-75928874 CTCCCATCTCTCTAGGCTTCAGG - Intergenic
1001280860 5:170385402-170385424 CTCGTGTCTCTCCCCGCTTCTGG + Exonic
1006543215 6:34757403-34757425 CCCGCCCCTCGCTCGGCTGCTGG + Exonic
1015786311 6:136923377-136923399 CTCTCGTCTCGCTCAGCACCTGG - Intronic
1021998112 7:26200606-26200628 CTCTCATCTCGCTCGGCTGCGGG - Exonic
1039947153 8:42140095-42140117 CGCGCGTCGCGCTCGGATTTCGG + Intergenic
1056134975 9:83622884-83622906 CTCGCGTCTCCCTGGGCTGGAGG - Intergenic
1057322883 9:94030720-94030742 CTCTCGTCACGGTCCGCTTCAGG + Intergenic